Editing Brandon:LabNotes/Project1/2015-9-18
Revision as of 02:18, 19 September 2015 by >Bsos (Created page with "==combinatorial method sequences detail == i5 universal connector AATGATACGGCGACCACCGAGATCTACAC i5_nXTv2 index primer AATGATACGGCGACCACCGAGATCTACAC[CTCTCTAT]TCGTCGGCAGCGTC ...")
Warning: You are editing an out-of-date revision of this page. If you publish it, any changes made since this revision will be lost.
Warning: You are not logged in. Your IP address will be publicly visible if you make any edits. If you log in or create an account, your edits will be attributed to your username, along with other benefits.