Editing
AlanFung:LabNotes/EZ/2009-3-24
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
='''2nd PCR run on GM20431 100 & 10 cells - on remaining eluted DNA'''= ==Objective== *Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells. *Increase the amount of template DNA to be used for PCR reaction ==Samples & Materials== *GM20431 cells *EZ DNA Methylation Direct Kit 03/11/09 *Primers - From IDT -------------------------------------------------- 0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG 0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA 0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT 0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA 0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT 0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA -------------------------------------------------- *Creating 100uM primer 0.1_F_chr22 27.9nmol RNAse free H2O 279uL 0.1_R_chr22 31.8nmol RNAse free H2O 318uL 0.8_F_chr21 31.30nmol RNAse free H2O 313uL 0.8_R_chr21 31.70nmol RNAse free H2O 317uL 0.9_F_chr8 30.10nmol RNAse free H2O 301uL 0.9_R_chr8 29.30nmol RNAse free H2O 293uL ------------------------------ *Making 3.3uM primer working solution Dilute 33uL 100uM primer with 967uL RNAse free H2O *Jurkat gDNA (100ug/mL) *Dilute 1uL stock gDNA with 99uL RNAse-free H20 *Agarose Gel ==Overview== *PCR amplification *Agarose Gel Electrophoresis ==Procedures== *PCR Sample A 100 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 2.8 2.8 2.8 RNAse free H20 5.2 5.2 5.2 ------------------------------------------------- Total 40uL Sample B 10 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 2.8 2.8 2.8 RNAse free H20 5.2 5.2 5.2 ------------------------------------------------- Total 40uL A-CHR22 F/R B-CHR21 F/R C-CHR8 F/R Perform PCR reaction in thermocycler Step1 96C, 3m Step2 95C, 30s Step3 62C, 1m Step4 72C, 1m Step5 Go to step2 repeat 39 times Step6 72C, 5m Step7 4C, Forever *Gel Electrophoresis Gel 1 Well 1 2 3 4 5 6 7 8 ----------------------------------------------------------------- Content Blank AA AB AC BA BB BC Ladder Sample 0 10 10 10 10 10 10 3 6X Loading Dye 0 2 2 2 2 2 2 3 ----------------------------------------------------------------- Total 14uL 9uL *Run gel at 135 V for 20 min. ==Result== [[Image:ZhangLab_2 2009-03-25 09hr 42min_crop.jpg]] *All 3 pairs of primers showed up on the 100 cells methylation *No bands at all for the 10 cells methylation ==Sugestion== *Repeat 10 cells methylation *Elute DNA with 8uL elution buffer *Use all 8uL dna as template for one pair of primer *Reduce washing step from two times to one *For one set (3x10cells- one washing before elution) *For the other set (2x10cells-two washing before elution
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information