Editing
Brandon:LabNotes/Project1/2012-8-6
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==Custom transposon with IVT amplification, round 2== *comparing custom transposon to nextera tagmentation more effectively since using the same cell line, GM12878. Before nextera tagmentation used GM20431 cells. **also using with proper controls and pure DNA. *procotols from shendure paper, [http://genome.cshlp.org/content/early/2012/03/30/gr.136242.111?top=1 shendure paper transposition] *using T7-top2 for transposition reactions [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:LabNotes/Project1/2012-5-7#Summary_for_using_with_T7tspn-top2: t7tspn-top2] *goal is to compare efficiency of DNA accessibility across different cellular concentrations. Also to test efficiency of tagmentation with custom transposon/transposome on pure DNA, and efficiency of amplification from IVT. **Using GM12878 cells. *Using mouse MEFs to check for possibility of contamination. want to obtain same type of results with custom transposon/IVT amplifiation as obtained [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:LabNotes/Project1/2012-7-27 in the previous accessibilty assay performed] *Improvments from last assay **DNase used to remove transposons and blocking primer after IVT and fragmentation **Use Rnase III for fragmentation. Random nomaer RT has more possible binding locations **Cleaning RNA with Zymo RNA cleaning kit ===UCSC genome browser mouse hypersensitivity tracts=== *is present on the UCSC Genome Browser on Mouse July 2007 (NCBI37/mm9) Assembly *DNaseI Hypersensitivity by Digital DNaseI from ENCODE/University of Washington *could be helpful to do comparisons against but a few issues. **immortalized cell lines were generated in house by the lab performing the study and are not buyable off of ATCC **other cells lines are harvested from mice at 8 weeks of age, such as cells from the cerebellum or B cell lymphocytes. **embryonic cells harvested and also had accessibiity performed on them. *Thus can make comparisons from my analysis with MEFs but don't know how comparable they will be to UCSC UW DNase I Hypersensitivity tracts. '''Why using RNAase III for fragmentation''' *Rnase III creates 5'-PO4 and 3'-OH termini on the fragments *however, Cuts ONLY dsRNA (used DNA blocking primer to block that) *Preferentially cuts from 5β and 3β ends (used blocking primer) *Rnase III results in 2 base 3β overhangs *Used in the generation of siRNAs for knockdown *Mg++ fragmentation creates 5' OH and 3' PO4 termini, thus have to do end repair. **End Repair with Shrink Akaline phosphatase, PNK, Antarctic phosphatase *random nonamer is less selective and can prime off of more sequences ===buffers compositions=== 1X T7 buffer: 400 mM Tris Hcl 8 mM MgCl2 2 mM spermidine-Hcl 25 mM NaCl PH 7.9 1X NEBNext RNase III Reaction Buffer: 10 mM Tris-HCl 10 mM Mg(Cl)2 1 mM DTT 60 mM NaCl pH 8.3 @ 25Β°C 10X Poly(A) Polymerase buffer: 500 mM Tris-HCl 2.5 M NaCl 100 mM MgCl2 pH 7.9 @ 25Β°C MMLV Invitrogen (though using clontech) 5X First-Strand Buffer 250 mM Tris-HCl (pH 8.3 at room temperature 375 mM KCl 15 mM MgCl2 0.1 M DTT ===Before starting protocols=== 1. Check if have enough reagents etc for the protocol *nextera transposomes *transposase/transposome *IVT reaction mixture *cells etc *blocking primer, RNase III, PolyA Polymerase 2. Purify GM12878 DNA from Gm12878 cells with DNeasy blood and tissue kit for cells (uses proteinase). quanititate DNA and aliquot to a standard concentration of 60 ng or a multiple of that. 3. Have to raise off MEFs with trypsin 1. suck off media 2. add 5 mL PBS/wash 3. suck off 4. 2 mL trypsin 5. put in 37C, 2 minutes 6. dilute with PBS, 10 mL 7. spin down and resuspend. 4. samples Samples: 1. 1000 cells IVT 2. 500 cells IVT 3. 100 cells IVT 4. 6 ng purified DNA IVT 5. 600 pg purified DNA IVT 6. 60 pg purified DNA IVT 7. 1000 cells nextera tagmentation 8. 500 cells nextera tagmentation 9. 100 cells nextera tagmentation 10. 6 ng purified DNA nextera tagmentation 11. 600 pg purified DNA nextera tagmentation 12. 60 pg purified DNA nextera tagmentation 13. 1000 cells MEFs IVT 14. 1000 cells MEFs nextera tagmentation 15. 1000 cells lysed without transposome complex IVT 16. pure DNA only (6 ng) IVT 17. Nuclease free H20 only IVT 18. 1000 cells lysed without transposome complex nextera tagmentation 19. pure DNA only (6 ng) nextera tagmentation 20. Nuclease free H20 only nextera tagmentation ===Nextera Tagmentation Protocol=== 1. See step 3 in IVT protocol. Do the cell lysis section for the "nextera tagmentation samples", samples 7,8,9,14,18. 2. Perform tagmentation on lysed cells and pure DNA. with 1:10 diluted nextera enzyme. (1:50 diluted in reaction) Dilute the enzyme: 1:10 For each rxn, used mix of: 1ul 5x LMW Buffer 2ul cell lysate 1ul diluted enzyme 1ul H2O ---------------------------- 5ul total / reaction 55C 10 min 3. Protease digestion of transposition reactions. To each tube, add: 1 uL Qiagen Protease, for 5 uL reaction 1 uL of .5 for .1 AU final. (stock is 5 AU and diluted 10X. want .5 AU/uL final []) Incubate: 50C 10 minutes, 70C 20 minutes 4. First step of 2-step PCR thermocycling, terminate curves before saturation. 6 ul Tagmentation reaction 25 ul KAPA SYBR FAST qPCR mix 1 ul Orange Primer (10uM) 1 ul Blue Primer (10uM) 0.5 ul Bst Pol (5U/ul) 16.5 ul H2O ---------------- 50 uL total Orange primer CCTTGCCAGCCCGCTCAG 18nt Blue primer CCTCCCTCGCGCCATCAG 18nt PCR cycling. 72C for 3 minutes is for gap fill in. 72C 3min -> 95C 30 sec -> (95C 10sec -> 58C 30 sec -> 72 3min) x 25 -> 72C 3min. Monitor the reactions on a real-time thermal cycler and terminate them before the curves reach saturation. 5. Begin 2-Step AMPure beads purification to remove primers, add index primers, for low input. (with forward read primer and reverse index primers) a. see 2-step [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:Protocols/AMPure_beads_purification2#AMPure_beads_purification_protocol_2-step_.28for_.3C.3D_5_ng.29 AMpure beads protocol], start from beginning for first purification b. After cleaning, second PCR reaction to add index primers Barcodes to use: Index 55, Nxtra atpr 7. 1000 cells nextera tagmentation Index 56, Nxtra atpr 8. 500 cells nextera tagmentation Index 57, Nxtra atpr 9. 100 cells nextera tagmentation Index 58, Nxtra atpr 10. 6 ng purified DNA nextera tagmentation Index 59, Nxtra atpr 11. 600 pg purified DNA nextera tagmentation Index 60, Nxtra atpr 12. 60 pg purified DNA nextera tagmentation Index 62, Nxtra atpr 14. 1000 cells MEFs nextera tagmentation Index 66, Nxtra atpr 18. 1000 cells lysed without transposome complex nextera tagmentation Index 67, Nxtra atpr 19. pure DNA only (6 ng) nextera tagmentation Index 68, Nxtra atpr 20. Nuclease free H20 only nextera tagmentation add the following to above dry tube: 25 uL KAPA HF mix (used KAPA SYBR FAST qPCR mix instead) 1 uL adaptor1 1 uL of adaptor2 (barcode) 23 uL nuclease free H2O c. PCR cycling for addition of index primer 5 cycles 72C 3min -> 95C 30 sec -> (95C 10sec -> 60C 30 sec -> 72 1 min) x 5 -> 72C 3min. d. second phase of AMpure beads 2-step beads purification. *can run on gel and check smears to see for library. *should be ready for sequencing now? ===IVT Protocol=== *If need to make more transposome, do first 2 steps. 1. annealing of ME sequence to T7 transposon sequence **a. Make 100 uM stock solution of T7tspn-top2 and T7tspn-bot. **b. Incubate 5 uL of each oligo (100uM) with 40 uL EB buffer at 95C for 2 minutes. Oligo's now at 10 uM in 50 uL. **c. cool to RT at 0.1 C/s 2. transposome complex generation, run controls!!! *add the below components into one tube and incubate for 20 minutes at RT 1.25 uL of annealed transposon 1.25 uL of 100% sterile glycerol 2.50 uL of Ez-TN5 transposase *store at -20, is good for a year 3. Prepare samples, lyse cells with lysis buffer use pure GM12878 DNA Samples: 1. 1000 cells IVT 2. 500 cells IVT 3. 100 cells IVT 4. 6 ng purified DNA IVT 5. 600 pg purified DNA IVT 6. 60 pg purified DNA IVT 13. 1000 cells MEFs IVT 15. 1000 cells lysed without transposome complex IVT 16. pure DNA only (6 ng) IVT 17. Nuclease free H20 only IVT *Make 10ml 10X lysis buffer (LB, 100mM Tris.Hcl pH 7.5, 100mM NaCl, 30mM MgCl2, 1% NP40, Crawford et al. PNAS 2003) in nuclease free H2O. *Prepare aliquots of lymphocytes GM12878 (have GM20431, GM12878 and MEFs) that contain 1000, 500, 100 cells. **spin down cells to concentrate them as necessary. *Prepare 2X LB from 10X buffer. mineral oil optional. *if needed make 4 or 6 uL solutions. keep 1:1 ratio of cells:lysis buffer *incubate below mixtures at 37C for 30 mins. {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''1. 1K IVT''' | align="center" style="background:#f0f0f0;"|'''2. 500 IVT''' | align="center" style="background:#f0f0f0;"|'''3. 100 IVT''' | align="center" style="background:#f0f0f0;"|'''7. 1K nxta''' | align="center" style="background:#f0f0f0;"|'''8. 500 nxta''' | align="center" style="background:#f0f0f0;"|'''9. 100 nxta''' | align="center" style="background:#f0f0f0;"|'''13. 1K MEF IVT''' | align="center" style="background:#f0f0f0;"|'''14. 1K MEF nxta''' | align="center" style="background:#f0f0f0;"|'''15. 1K IVT con''' | align="center" style="background:#f0f0f0;"|'''17. NTC IVT''' | align="center" style="background:#f0f0f0;"|'''18. 1K nxta con''' | align="center" style="background:#f0f0f0;"|'''20. NTC nxta''' |- | cells||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul PBS||1 ul||1 ul PBS |- | 2X LB||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul |- | |} 4. transposition reaction, using (T7tspn-top2) *add the below into one tube and incubate for 10 minutes at 55C. 1 uL nextera LMW buffer 2 uL lysed/pure genomic DNA (X ng/pg DNA) 1.2 uL Nuclease free water .8 uL prepared T7 transposomes (MAKE SURE TO ADD LAST) (if was proportional to shendure would use .625 uL) ___________ 5 uL total solution method used in shendure paper: 4 uL nextera HMW buffer X uL genomic DNA at prepared quantities X uL Nuclease free water ______ 17.5 uL total solution add 2.5 uL of prepared transposomes 5. Protease digestion of transposase, protease inactivation To each tube, add: 1 uL Qiagen Protease, for 5 uL reaction 1 uL of .5 for .1 AU final. (stock is 5 AU and diluted 10X. want .5 AU/uL final []) Incubate: 50C 10 minutes, 70C 20 minutes 6. Fill in reaction *Add 6 uL 2X taq polymerase, run at 72C for 3 minutes. (same as nextera) 7. Maxiscript (Ambion) T7 Protocol, IVT *DNA from PCR can be used directly in the MAXIscript Kit without any pretreatment or purification. a. Thaw 10X Transcription Buffer and ribonucleotide solutions. Store the ribonucleotides (A, C, G, U) on ice, but keep 10X transcription buffer at room temp b. Assemble reaction mixture at room temperature, ADD IN ORDER AND MIX THOROUGHLY!!!! bring to 20 uL with Nuclease free water X uL DNA template (list 1 ug) 2 uL 10X Transcription Buffer 1 uL 10 mM ATP 1 uL 10 mM CTP 1 uL 10 mM GTP 1 uL 10 mM UTP 2 uL T7 Enzyme Mix b. Incubate reactions at 37C overnight for ~16 hours. (>10 uM limiting nucleotide) 8. Clean RNA with with Zymo RNA Clean & Concentrator-5 Kit *can quantitate with Qubit if needed 9. Perform RNase III fragmentation (NEB): Starting Material: Purified mRNA (50β250 nanograms) 1. Add 5' end blocking DNA primer and do annealing to form DNA-RNA hybrid. *a. add 2 uL of blocking oligo (10 uM) to aliquot RNA sample that will be used in step 2. use T7-frag-block-top2 for T7-top2. T7-frag-block for T7-top3 *b. Incubate at 95C for 2 minutes. *c. cool to RT at 0.1 C/s 2. Mix the following components in a sterile PCR tube: X uL Purified mRNA + blocking primer (50-250 nanograms) .5 uL RNase III (1 unit/ΞΌl) 1 uL RNase III Reaction Buffer (10X) 5.5 uL Nuclease-Free Water add in DNA primer to protect 5' end since don't want degradation?? _______ 10 uL total volume 3. Incubate in a preheated thermal cycler for 5 minutes at 37Β°C. 4. Transfer tube to ice. 10. (ONLY DID ZYMO CLEANUP, STILL WORKED FINE 2012/08/28 update) DNase I digestion and Zymo RNA clean and concentrator cleanup. removes dsDNA. does not remove ss or DNA:RNA hybrids at high efficiency, 1:500 that of dsDNA. better than nothing... *Resuspend in appropriate volume in nuclease free H2O. *not doing protease digestion since seems it wasnt as effective in previous [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:LabNotes/Project1/2012-6-6 RNase III fragmentation] 11. Quanitate RNA with QUbit 12. Poly(A) Addition with polyA polymerase (Enzymatics) *enzymatics PolyA polymerase. a. assemble reaction: 2 uL 5X SMART MMLV first strand buffer (rather than 10X polyA buffer) 1 uL polyA enzyme 1 uL 10 mM ATP bring to 10 uL with RNA or w/e b. Incubate at 37C for 10 minutes c. Heat inactivate at 70C for 20 minutes. (rui and NEB) 13. single strand synthesis MMLV RT (Clontech) *Followed protocol for [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:Protocols/SMART_MMLV_RT SMART MMLV Reverse Transcriptase] 20 uL reaction 1. Add 2.5 uL 20 uM primer stock to RNA sample. Bring to final volume of 12.5 uL with Nuclease free H2O (one from BENG160 class, T20VN_PE_R) 2. heat the mixture to 70C fo 3 minutes. Immediately cool on ice. 3. Add the following to the reaction. 2 uL 5X first strand buffer 2 uL dNTP mix 2 uL 100 uM DTT 1 uL N-H20 .5 uL SMART MMLV RT and mix (ADD LAST!!!!!) ____ 20 uL total 4. Incuvate at 42C for 60 minutes 5. Terminate the reaction by heating at 70C for 10 minutes 14. second strand synthesis (qPCR) (KAPA), addition of barcodes Samples: Index 49, N2 adaptor 1. 1000 cells IVT Index 50, N2 adaptor 2. 500 cells IVT Index 51, N2 adaptor 3. 100 cells IVT Index 52, N2 adaptor 4. 6 ng purified DNA IVT Index 53, N2 adaptor 5. 600 pg purified DNA IVT Index 54, N2 adaptor 6. 60 pg purified DNA IVT Index 61, N2 adaptor 13. 1000 cells MEFs IVT Index 63, N2 adaptor 15. 1000 cells lysed without transposome complex IVT Index 64, N2 adaptor 16. pure DNA only (6 ng) IVT Index 65, N2 adaptor 17. Nuclease free H20 only IVT KAPA SYBR FAST qPCR mix until saturation, X35 cycles 25 uL KAPA SYBR 4 uL primers, 2 uL F, 2 uL R (T7-top2-PCR-iaf or T7-top3-PCR-iaf) and (PCR_R.N2Ind[XX]) 1 uL H2O 20 uL DNA template (use whole RT reaction) KAPA SYBR cycles: 98C 3min, (98C for 30s, 60C for 30s, 72C for 2 min) X35, 72C for 5 min, 4C forever *terminate before curves saturate (usually cycle 6-7) 15.qiaquick cleanup *can quanitate with nanodrop *run qiaquick to clean sample before performing qPCR. 16. Gel Size selection *gel size select from 400-800 bp, follow gel size selection protocol *do not need to include controls. 17. Cloning and Transformation, then genewiz sequencing for verification of inserts 18. Submit for sequencing if genewiz sequencing checks out. ===Results=== '''Nextera results and gels''' *nanodrop results for nextera samples {| {{table}} | align="center" style="background:#f0f0f0;"|'''Sample ID''' | align="center" style="background:#f0f0f0;"|'''smpl #''' | align="center" style="background:#f0f0f0;"|'''ng/ul''' |- | 1000 cell||7||75.36 |- | 500 cell||8||88.23 |- | 100 cell||9||55.61 |- | 6 ng||10||61.54 |- | 600 pg||11||9.69 |- | 60 pg||12||3.99 |- | MEF||14||107.29 |- | NTC||18||4.44 |- | NTC||19||4.82 |- | NTC||20||9.31 |- | |} *ran gel after 2 step AMPure beads purification (addition of illuminia primers, barcodes) ** Interestingly more sample is detected with lower cell concentrations. Probably because with lower cell concentrations there are more viable fragments created, since more insertions will happen over less DNA. Same amount of transposome was used for each reaction. Nonviable fragments could be created by wrong ends and distance between insertions is to far. **Not enough DNA for samples 11, 12? **MEF's (14) and NTCs worked as expected. [[File:ZhangLab 2 2012-08-16 12hr 38min-labeled.jpg|600px]] *qPCR curves for blue/orange amplification of products 1. 1000 cells nextera 2. 500 cells nextera 3. 100 cells nextera 4. 6 ng purified DNA nextera 5. 600 pg purified DNA nextera 6. 60 pg purified DNA nextera 7. 1000 cells MEFs nextera 8. 1000 cells lysed without transposome nextera 9. pure DNA only nextera 10. N-H2O only nextera [[File:2012-08-15 nextera accessibility orange blue amp.bmp|600[x]] '''IVT amplification results/gels''' *Used 1 uL for TBU gel, 2 uL for Qubit quantitation {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''[Sample]''' | align="center" style="background:#f0f0f0;"|'''ng/uL''' | align="center" style="background:#f0f0f0;"|'''eluted (uL)''' | align="center" style="background:#f0f0f0;"|'''total RNA ng''' |- | 1000 cell||43.3||ng/uL||14||606.2 ng |- | 500 cell||29.3||ng/uL||14||410.2 ng |- | 100 cell||15.3||ng/uL||14||214.2 ng |- | 6 ng||43.1||ng/uL||14||603.4 ng |- | 600 pg||6.4||ng/uL||14||89.6 ng |- | 60 pg||Out of Range|||||| |- | MEF||59||ng/uL||14||826 ng |- | NTC||Out of Range|||||| |- | NTC||Out of Range|||||| |- | NTC||Out of Range|||||| |- | |} *graph of ng RNA versus cell number for IVT RNA amplification. Linear based on cell number. [[File:Ng RNA vs cell number IVT.png]] *RNA after IVT amplification, TBU gel [[File:ZhangLab 2 2012-08-16 16hr 05min-labeled.jpg|600px]] *qPCR curves for barcode/adaptor addition *Negative controls amplified thus wierd, but looks fine when running TBE gel. 1. 1000 cells IVT 2. 500 cells IVT 3. 100 cells IVT 4. 6 ng purified DNA IVT 5. 600 pg purified DNA IVT 6. 60 pg purified DNA IVT 7. 1000 cells MEFs IVT 8. 1000 cells lysed without transposome IVT 9. pure DNA only IVT 10. N-H2O only IVT [[File:2012-08-15 IVT accessibility barcode addition.bmp|600px]] *After barcode/illuminia adaptor addition. TBE gel, 50 uL sample total fragments above 127 bp will have an insert, at least 157 for good insert 5β end GGGAGATCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG 3β end T20VN_PE_R AAAAAAAAAAAAAAAAAAAAACTAGCCTTCTCGCCAAGTCGTCCTTACG 3β end of PCR_R.N2Ind[XX] with ILA adaptor GCTCGAACATTAGAGCATACGGCAGAAGACGAAC [[File:ZhangLab 2 2012-08-17 15hr 12min-labeled.jpg|600px]] '''gel size selection''' *after gel size selection for IVT samples and for nextera samples *quanitated DNA in smears on gels from above and combined IVT samples, and nextera samples separately since are barcoded already. *used same amount of DNA per sample except samples that did not have enough. *IVT samples {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | ||for 100 ng total each sample|| |- | 1000 cell||2.428363987||uL |- | 500 cell||3.389656805||uL |- | 100 cell||8.85869023||uL |- | 6 ng||2.587997939||uL |- | 600 pg||11.27038606||uL |- | 60 pg||50.15563592||use 20 uL of sample. |- | 1000 MEF||2.748981532||uL |- | |||| |- | ||||~700 ish ng total |- | ||||2 wells on gel |- | ||51.43971247|| |- | |} *nextera samples {| {{table}} | align="center" style="background:#f0f0f0;"|'''sample''' | align="center" style="background:#f0f0f0;"|'''ng''' | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''''' |- | 1000 cell||5.882608179||uL|| |- | 500 cell||2.655553673||uL|| |- | 100 cell||1.896579441||uL|| |- | 6 ng||8.937349074||uL|| |- | 600 pg||-567.899155||9||uL |- | 60 pg||-197.013903||9||uL |- | 1000 MEF||3.599657838||uL|| |- | |||||| |- | |||||| |- | ||40.97174821||500 ng total, 2 wells|| |- | |} *gel size selection gel check [[File:ZhangLab 2 2012-08-21 16hr 38min-labeled.jpg|600px]] '''cloning and transformation with gel size selected sample''' *alot did not amplify, not sure why. though if one worked then it is still comparable to the cloning/transformation that was done [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:LabNotes/Project1/2012-6-29#update_7.2F6.2F2012_IVT_on_pure_DNA_samples.2FIVT_again_on_cells with the random nonamer] **gave normal ratios of blue to white colonies **could be that need to do transformation again. **PCR didn't work? could redilute primers, use diff MM etc. **ends not A-tailed well enough? **POSITIVE result is that uninformative fragments (330 bp) are not present. not sure why though. *send in samples 1,3,4,8,12,13,14,16,24,33,42,43 for sequencing *IVT with RNase III fragmentation has better cloning/transformation statistics than [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:LabNotes/Project1/2012-6-29 random nonamer method], which out of 77 clones, 10.3% had a valid genomic insert. half of them had incorrect ends, thus true statistics were around 5%. all in this analysis had correct 5', 3' ends for sequencing. *sequence analysis file [[Media:2012-08-24 Rnase III fragmentation protocol.docx]] {| {{table}} | align="center" style="background:#f0f0f0;"|'''''' | align="center" style="background:#f0f0f0;"|'''samples''' | align="center" style="background:#f0f0f0;"|'''possible''' | align="center" style="background:#f0f0f0;"|'''validated''' | align="center" style="background:#f0f0f0;"|'''% val''' |- | IVT||1-22||8||4||.1818 |- | nextera||23-44||4||3||.13536 |- | |} [[File:ZhangLab 2 2012-08-23 14hr 09min-labeled.jpg|600px]] [[File:ZhangLab 2 2012-08-23 14hr 11min-labeled.jpg|600px]] [[File:ZhangLab 2 2012-08-23 14hr 19min-labeled.jpg|600px]] [[File:ZhangLab 2 2012-08-23 14hr 20min-labeled.jpg|600px]] ===Notes ETC=== *since previous frag block was designed for T7-top3. T7-frag-block-top2 5'- CTGTCTCTTATACACATCTCTGATGGCGCGAGGGAGGATCTCCC/3InvdT/ Tm= 81.45 *Effeciency of DNase I to degrade ssDNA and DNA:RNA hybrids is 500X less effecient, [http://www.invitrogen.com/site/us/en/home/References/Ambion-Tech-Support/nuclease-enzymes/general-articles/dnase-i-demystified.html according to Invitrogen site] thus use longer incubation? Barcodes used: Samples: Index 49, N2 adaptor 1. 1000 cells IVT Index 50, N2 adaptor 2. 500 cells IVT Index 51, N2 adaptor 3. 100 cells IVT Index 52, N2 adaptor 4. 6 ng purified DNA IVT Index 53, N2 adaptor 5. 600 pg purified DNA IVT Index 54, N2 adaptor 6. 60 pg purified DNA IVT Index 55, Nxtra atpr 7. 1000 cells nextera tagmentation Index 56, Nxtra atpr 8. 500 cells nextera tagmentation Index 57, Nxtra atpr 9. 100 cells nextera tagmentation Index 58, Nxtra atpr 10. 6 ng purified DNA nextera tagmentation Index 59, Nxtra atpr 11. 600 pg purified DNA nextera tagmentation Index 60, Nxtra atpr 12. 60 pg purified DNA nextera tagmentation Index 61, N2 adaptor 13. 1000 cells MEFs IVT Index 62, Nxtra atpr 14. 1000 cells MEFs nextera tagmentation Index 63, N2 adaptor 15. 1000 cells lysed without transposome complex IVT Index 64, N2 adaptor 16. pure DNA only (6 ng) IVT Index 65, N2 adaptor 17. Nuclease free H20 only IVT Index 66, Nxtra atpr 18. 1000 cells lysed without transposome complex nextera tagmentation Index 67, Nxtra atpr 19. pure DNA only (6 ng) nextera tagmentation Index 68, Nxtra atpr 20. Nuclease free H20 only nextera tagmentation *N2 adaptor with illuminia adatpor on the 5' end. My modifications for T7-tspns for 5' addition primers To use with (T7-top and T7-top2) transposons 5β- [AATGATACGGCGACCACCGA][GATCT][CTCCCTCGCGCCATCAGAGAT] -3β (Tm=86.59) ILA adaptor blue Top2-5βend (T7-top2-PCR-iaf) Tm=66.79 (can be used if top1 is used for transposition) *N2 adaptors with barcodes and illuminia adaptors (N9_PE_R and T20VN_PE_R) {| {{table}} | align="center" style="background:#f0f0f0;"|'''Barcode ID''' | align="center" style="background:#f0f0f0;"|'''Barcode''' | align="center" style="background:#f0f0f0;"|'''Primer''' | align="center" style="background:#f0f0f0;"|'''Primer Name''' |- | Ind49||ACACAG||CAAGCAGAAGACGGCATACGAGATACACAGCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind49 |- | Ind50||AAAGGT||CAAGCAGAAGACGGCATACGAGATAAAGGTCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind50 |- | Ind51||GCGATA||CAAGCAGAAGACGGCATACGAGATGCGATACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind51 |- | Ind52||CGTGTC||CAAGCAGAAGACGGCATACGAGATCGTGTCCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind52 |- | Ind53||GTAGAA||CAAGCAGAAGACGGCATACGAGATGTAGAACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind53 |- | Ind54||GGACGT||CAAGCAGAAGACGGCATACGAGATGGACGTCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind54 |- | Ind55||AGTCGA||CAAGCAGAAGACGGCATACGAGATAGTCGACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind55 |- | Ind56||GTCTGA||CAAGCAGAAGACGGCATACGAGATGTCTGACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind56 |- | Ind57||GAAGGA||CAAGCAGAAGACGGCATACGAGATGAAGGACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind57 |- | Ind58||ATGCTG||CAAGCAGAAGACGGCATACGAGATATGCTGCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind58 |- | Ind59||TCTATC||CAAGCAGAAGACGGCATACGAGATTCTATCCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind59 |- | Ind60||ATCTGT||CAAGCAGAAGACGGCATACGAGATATCTGTCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind60 |- | Ind61||ATAGAG||CAAGCAGAAGACGGCATACGAGATATAGAGCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind61 |- | Ind62||GCTAAA||CAAGCAGAAGACGGCATACGAGATGCTAAACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind62 |- | Ind63||ACCAGG||CAAGCAGAAGACGGCATACGAGATACCAGGCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind63 |- | Ind64||CCAACT||CAAGCAGAAGACGGCATACGAGATCCAACTCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind64 |- | Ind65||AAGGAA||CAAGCAGAAGACGGCATACGAGATAAGGAACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind65 |- | Ind66||CCTCCA||CAAGCAGAAGACGGCATACGAGATCCTCCACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind66 |- | Ind67||CACGTC||CAAGCAGAAGACGGCATACGAGATCACGTCCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind67 |- | Ind68||CATAAC||CAAGCAGAAGACGGCATACGAGATCATAACCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind68 |- | Ind69||CCATAT||CAAGCAGAAGACGGCATACGAGATCCATATCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind69 |- | Ind70||GAAGTC||CAAGCAGAAGACGGCATACGAGATGAAGTCCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind70 |- | Ind71||CAAAGA||CAAGCAGAAGACGGCATACGAGATCAAAGACTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind71 |- | Ind72||TGGCAG||CAAGCAGAAGACGGCATACGAGATTGGCAGCTCGGCATTCCTGCTGAACCGCTCTT||PCR_R.N2Ind72 |- | |} *nextera Adaptor 1, matches blue primer, CCTCCCTCGCGCCATCAG, 18nt Adaptor 1*: 5β²-AATGATACGGCGACCACCGAGATCTACACGCCTCCCTCGCGCCATCAG-3β² *nextera barcoded adaptor 2's and illuminia adaptors. matches orange primer, Orange primer CCTTGCCAGCCCGCTCAG, 18nt {| {{table}} | align="center" style="background:#f0f0f0;"|'''Barcode ID''' | align="center" style="background:#f0f0f0;"|'''Barcode''' | align="center" style="background:#f0f0f0;"|'''Primer''' |- | Ind49||ACACAG||CAAGCAGAAGACGGCATACGAGATACACAGCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind50||AAAGGT||CAAGCAGAAGACGGCATACGAGATAAAGGTCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind51||GCGATA||CAAGCAGAAGACGGCATACGAGATGCGATACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind52||CGTGTC||CAAGCAGAAGACGGCATACGAGATCGTGTCCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind53||GTAGAA||CAAGCAGAAGACGGCATACGAGATGTAGAACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind54||GGACGT||CAAGCAGAAGACGGCATACGAGATGGACGTCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind55||AGTCGA||CAAGCAGAAGACGGCATACGAGATAGTCGACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind56||GTCTGA||CAAGCAGAAGACGGCATACGAGATGTCTGACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind57||GAAGGA||CAAGCAGAAGACGGCATACGAGATGAAGGACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind58||ATGCTG||CAAGCAGAAGACGGCATACGAGATATGCTGCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind59||TCTATC||CAAGCAGAAGACGGCATACGAGATTCTATCCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind60||ATCTGT||CAAGCAGAAGACGGCATACGAGATATCTGTCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind61||ATAGAG||CAAGCAGAAGACGGCATACGAGATATAGAGCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind62||GCTAAA||CAAGCAGAAGACGGCATACGAGATGCTAAACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind63||ACCAGG||CAAGCAGAAGACGGCATACGAGATACCAGGCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind64||CCAACT||CAAGCAGAAGACGGCATACGAGATCCAACTCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind65||AAGGAA||CAAGCAGAAGACGGCATACGAGATAAGGAACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind66||CCTCCA||CAAGCAGAAGACGGCATACGAGATCCTCCACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind67||CACGTC||CAAGCAGAAGACGGCATACGAGATCACGTCCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind68||CATAAC||CAAGCAGAAGACGGCATACGAGATCATAACCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind69||CCATAT||CAAGCAGAAGACGGCATACGAGATCCATATCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind70||GAAGTC||CAAGCAGAAGACGGCATACGAGATGAAGTCCGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind71||CAAAGA||CAAGCAGAAGACGGCATACGAGATCAAAGACGGTCTGCCTTGCCAGCCCGCTCAG |- | Ind72||TGGCAG||CAAGCAGAAGACGGCATACGAGATTGGCAGCGGTCTGCCTTGCCAGCCCGCTCAG |- | |} Read primers used for sequencing: T7tspn-Read1 and Nextera Read 1 primer are exactly the same except for first nucleotide on 5' end. for IVT generated samples: T7tspn-Read1 5'- TCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG -3' N2RevSeq2 (read primer 2) 5'- CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT -3' N2IndSeq 5'- AAGAGCGGTTCAGCAGGAATGCCGAG -3' for Nextera generated samples: Nextera Read 1 Primer: 5β²- GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG -3β² Nextera Read 2 primer: 5β²- GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG -3β² Nextera Index Read Primer: 5β²-CTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGCAGACCG-3β² Stuff used for RNA-seq for BENG160 class 5β end addition primers TSO_N10_BC[XX] [AAGCAGTGGTATCAACGCAGAGdUdU]NNNNNNNNNNTTTAGGrGrGrG adatpor1 5'- AAG CAG TGG TAT CAA CGC AGA G/ideoxyU//ideoxyU/ NNN NNN NNN NTT TAG GrGrGrG -3' P1-STRT 5β- [AATGATACGGCGACCACCGA][GATCT][AAGCAGTGGTATCAACGCAGAGT] -3β (Tm=82.59) ILA adaptor blue Tm=64.31 adaptor1 Tm=61.02 STRT-SEQ 5'- [GATCT][AAGCAGTGGTATCAACGCAGAGTT] -3' adaptor1 3β end addition primers T20VN_PE_R 5'-Bio-[GCATTCCTGCTGAACCGCTCTT]CCGATCTTTTTTTTTTTTTTTTTTTTTVN -3β (Tm=78.92) adaptor2 Tm=65.68 PCR_R.N2Ind[XX] (XX= index number) 5β- [CAAGCAGAAGACGGCATACGAGAT][TACAAG]CTCG][GCATTCCTGCTGAACCGCTCTT] -3β (Tm=87.12) ILA adaptor orange bc adaptor2 Tm=65.68 My modifications for T7-tspns for 5' addition primers To use with (T7-top and T7-top2) transposons 5β- [AATGATACGGCGACCACCGA][GATCT][CTCCCTCGCGCCATCAGAGAT] -3β (Tm=86.59) ILA adaptor blue Top2-5βend (T7-top2-PCR-iaf) Tm=66.79 (can be used if top1 is used for transposition) To use with (T7-top3) transposon 5β- [AATGATACGGCGACCACCGA][GATCT][GGGAGACATTAAGATGTGTATAAGAGACAG] -3β (Tm=81.40) ILA adaptor blue Top3-5βend (T7-top3-PCR-iaf) Tm=60.71
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information