Editing
Chris:LabNotes/sci-Methyl Seq/Calendar/2017/2017-6-12
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
=sci-Methyl Seq Barcode 1 Design v3; Barcode 2 Design v2= ==Background== *Based on previous tests, it looks as though the original plan of second strand synthesis with an annealed ssDNA Adapter 2 doesn't work very well (it creates many unexpected band sizes). Consequently, in order to address this challenge, we want to redesign how we add Adapter 2 to our DNA fragments. *We propose the following experimental pipeline, which we will be testing in parallel with the original annealing/second strand synthesis protocol: End Repair/dA-Tailing 5' '''-----'''A 3' 3' A'''-----''' 5' | V Add Adpt1_v3: 5' /5Phos/-----TTDD[Barcode1]-----CC 3' 3' T-----AA''DD''[''Barcode1'']----- 5' | V Ligate Adpt1_v3 (using same optimized ligation protocol as before) 5' -----[''Barcode1'']''DD''AA-----T|'''-----'''A|-----TTDD[Barcode1]-----CC 3' 3' CC-----[Barcode1]DDTT-----|A'''-----'''|T-----AA''DD''[''Barcode1'']----- 5' | V Add Adpt2_v2: 5' /5Phos/-----[''Barcode2'']'''''DDDDDDDD'''''----- 3' 3' GG-----[Barcode2]'''DDDDDDDD'''----- 5' | V Ligate Adpt2_v2 (using same optimized ligation protocol as before) Nick V 5' -----'''DDDDDDDD'''[Barcode2]-----GG|-----[''Barcode1'']''DD''AA-----T|'''-----'''A|-----TTDD[Barcode1]-----CC|-----[''Barcode2'']'''''DDDDDDDD'''''----- 3' 3' -----'''''DDDDDDDD'''''[''Barcode2'']-----|CC-----[Barcode1]DDTT-----|A'''-----'''|T-----AA''DD''[''Barcode1'']-----|GG-----[Barcode2]'''DDDDDDDD'''----- 5' ^ Nick | V Denature/separate fragments (will break up DNA at nicks) 5' -----[''Barcode1'']''DD''AA-----T|'''-----'''A|-----TTDD[Barcode1]-----CC|-----[''Barcode2'']'''''DDDDDDDD'''''----- 3' 3' -----'''''DDDDDDDD'''''[''Barcode2'']-----|CC-----[Barcode1]DDTT-----|A'''-----'''|T-----AA''DD''[''Barcode1'']----- 5' ==Barcode 1 Adapter Design (v3)== *We want to add an additional CC sequence to the 3' end of the top strand, while we can keep the same Adpt1_v2_comp as below: Adpt1_v3 5' /5Phos/TTAGAGGTGGTCCCTCCTACCCGGCGTTTCC 3' Adpt1_v2_comp 3' TAATCTCCACCAGGGAGGATGGGCCGCAAA 5' *<span style="color:red">'''NOTE: We only need to order Adpt1_v3 and we will just use the same Adpt1_v2_comp as before'''</span> ==Barcode 2 Adapter Design (v2)== *We likewise need to redesign Adpt2 sequence. We will keep mostly the same design as <http://genome-tech.ucsd.edu/LabNotes/index.php/Chris:LabNotes/sci-Methyl_Seq/Calendar/2017/2017-4-28> but we will change the following: **Add a complementary GG sequence to the bottom strand such that it Adpt2 will be able to bind and ligate to the sticky end formed after Adpt1 ligation **Remove the complementary Filler 2 sequence from the adapter since that is no longer necessary for annealing (instead, the GG sequence will be enough to anneal to the sticky end) **Make sure that the top strand (i.e. Filler 3, Barcode, and UMI), which is ligated onto the DNA fragment, contains no C's. Otherwise, that may be potentially converted to G's during bisulfite conversion. Adpt2_v2 5' /5Phos/[GATAGG]'''TGGAGAGG'''GGAGAGGAGGTAAGGAGAGG 3' Adpt2_v2_comp 3' GG[CTATCC]'''ACCTCTCC'''CCTCTCCTCCATTCCTCTCC 5' *We can use the following sequence to perform PCR in order to double check that Adtp2_v2 was added onto the DNA fragment correctly: Adpt2_v2_PCR 5' CCTCTCCTTACCTCCTCTCCCCTCTCCA 3' <- This will anneal onto the 3' end of Adpt2_v2 (now includes Filler 3 and UMI sequence in order to increase melting temperature of fragment for PCR) and polymerize across the insert as follows: 5' -----[''Barcode1'']''DD''AA-----T|'''-----'''A|-----TTDD[Barcode1]-----CC|-----[''Barcode2'']'''''DDDDDDDD'''''----- 3' <'''--------'''----- 5' We want to make sure that polymerization ends at the end of Filler2 from Adpt1 instead of continuing on to include the reverse complementary sequence of Filler 3
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information