Editing
Kun:LabNotes/MONOD/2014-11-23
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==Selector v2 Round 2== ===Step 1. RE digestion=== *Materials: **gDNA: HAPMAP gDNA from Coriell GM18506 (diluted to 50ng/ul) **BfaI: NEB, R0568S, 10U/ul **DpnII: NEB, R0147S, 50U/ul **MspI: NEB, R0106S, 20U/ul *To save time for the future test, I would set up more reactions than I need for this first test. x 4 gDNA (50ng/ul) 8 ul 10x CutSmart Buffer 8 ul DpnII(5U/ul) 2 ul BfaI (10U/ul) 4 ul H2O 58 ul Total 80 ul x 4 gDNA (50ng/ul) 8 ul 10x CutSmart Buffer 8 ul MspI (10U/ul) 4 ul H2O 60 ul Total 80 ul 37C for 1 hour, 80C for 20min, 4C hold. ===Step 2. Target capture=== *Reagents: **LMS_selector v2 probes (92nt; conc=1ng/ul, or 33nM) **Linker.V2 (stock primer 100uM; working tube 10uM): /5phos/GTTGGAGGCTCATCGTTATCCGACGGTAGTGTATGTTATCGAGGTCCGAC **Linker.V2_UMI (stock primer 100uM; working tube 10uM): /5phos/GTTGGAGGCTCATCGTTATCCGACGCCTATCGGGAAGCTGAAGNNNNNNNNNNGGTAGTGTATGTTATCGAGGTCCGAC **AmpLigase **Taq polymerase *Some adjustments: **Carefully match the probe:template ratio. **Test a gradient of annealing temperature (50C, 54C, 57C, 60C). **Test adding pre-annealed probe/linker duplex. Prepare probe/linker mix A (no UMI) LMS_selector v2 probes 20ul (probe:template=200:1) Linker.V2 (100nM) 20ul (linker:probe=3:1) 10X AmpLigase buffer 5ul Prepare probe/linker mix B (with UMI) LMS_selector v2 probes 20ul (probe:template=200:1) Linker.V2_UMI (100nM) 20ul (linker:probe=3:1) 10X AmpLigase buffer 5ul 94C 2min -> 37C 10min Mix the MspI and DpnII/BfaI digested gDNA (20ul+20ul->40ul) Set up the following reactions, for annealing temperature there are six tubes: 1 w/o UMI, 50ng 2 w/o UMI, 20ng 3 w/o UMI, 0ng 4 w/ UMI, 50ng 5 w/ UMI, 20ng 6 w/ UMI, 0ng x 8 x 8 x 8 Mix digested gDNA 5ul 2ul 0ul 10X AmpLigase buffer 1.5ul 1.8ul 1.8ul 25mM MgCl2 1.6ul 1.6ul 1.6ul NAD (50mM) 0.4ul 0.4ul 0.4ul H2O 7ul 12.2ul 14.2ul Total 15.5ul 18ul 18ul 94C 2min -> 50/52.8/57.4/60C, add 4.5ul/2ul/2ul pre-annealed probe/linker mix per tube and incubate for 16-20 hours (started at 3pm on 11/24) -> add 1ul of 2.5U/ul Ampligase (1:1 dilution with H2O) to each tube (9am on 11/25) Note that I noticed some bubbles in many tubes, probably caused by the adding of probe/linker mix. So I briefly spin the tubes, and place them back to the thermal cycler. I decided to let the ligation runs longer just in case the probes didn't anneal well with the template. -> 50/54/57/60C for 2 hour -> 94C for 2min -> 8C hold. -> add 2ul of Exo I/III mix -> 37C 2h -> 80C 20min. PCR amplification Circularization reaction 5 ul Kapa QPCR Master Mix 25 ul Linker.V2F (10uM) 1 ul Linker.V2R (10uM) 1 ul H2O 9.0 ul Total 25.0 ul 95C 5min -> (95C 15sec -> 58C 30sec -> 72C 15 sec) x 30 Monitor the amplification curves and terminate the reactions before plateauing. [[Image:Selector_2014-11-25_50C.png|300px]][[Image:Selector_2014-11-25_53C.png|290px]] [[Image:Selector_2014-11-25_57C.png|290px]][[Image:Selector_2014-11-25_60C.png|300px]] *Selectors did work, with and without UMIs. Higher annealing temperatures (57.4C, 60C) appeared to work better. Even the reactions with 20ng input DNA worked. Since only 5ul was used for PCR, this means 4-5ng of input DNA is sufficient. There were some background amplification, which led to discrete bands. *Rui will run PCR using the barcoded primers to make libraries and obtain real sequencing data.
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information