Editing
Matt:LabNotes/2015-1-21
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==CA12k_Nov2014 V4 and V7 in vitro Capture== ===Calculate Probes Needed=== ====V4==== {| {{table}} | align="center" style="background:#f0f0f0;"|'''Probe:target''' | align="center" style="background:#f0f0f0;"|'''1000:1''' | align="center" style="background:#f0f0f0;"|'''''' |- | Probe size||3514||probes |- | DNA templet||300||ng |- | gDNA MW||1.95x10^12||g/mol |- | gDNA (300ng) ||1.5385x10^-19||mol |- | Probe (1000:1)||1.5385x10^-16||mol |- | Probe MW (3514, 150nt)||1.71585106x10^8||g/mol |- | Amount Probe req'd||26.4||ng |} ====V7==== {| {{table}} | align="center" style="background:#f0f0f0;"|'''Probe:target''' | align="center" style="background:#f0f0f0;"|'''1000:1''' | align="center" style="background:#f0f0f0;"|'''''' |- | Probe size||2486||probes |- | DNA templet||300||ng |- | gDNA MW||1.95x10^12||g/mol |- | gDNA (300ng) ||1.5385x10^-19||mol |- | Probe (1000:1)||1.5385x10^-16||mol |- | Probe MW (2486, 150nt)||1.21388894x10^8||g/mol |- | Amount Probe req'd||18.7||ng |} ===Probes, Target and Ampligase Buffer Mix=== *gDNA: 12878 (80.3ng/ul) *[[Matt:LabNotes/2015-1-12 | First strand cDNA from UHRR]] *[[Matt:LabNotes/2014-11-19#Final_Probes_to_Order:_Trim_to_12.2C000_probes | CA12k_Nov2014 Probes]] **[[Matt:LabNotes/2015-1-5#TBU_Gel_Quantification | V4 (10.7 ng/ul)]] **[[Matt:LabNotes/2015-1-15#TBU_Gel_Quantification | V7 (39.2 ng/ul)]] ***Dilute 2ul into 4ul for easier more accurate pipetting {| {{table}} | align="center" style="background:#f0f0f0;"|'''Sample #''' | align="center" style="background:#f0f0f0;"|'''Sample Description''' | align="center" style="background:#f0f0f0;"|'''Probes''' | align="center" style="background:#f0f0f0;"|'''Target''' | align="center" style="background:#f0f0f0;"|'''10X Ampligase Buffer''' | align="center" style="background:#f0f0f0;"|'''H2O''' | align="center" style="background:#f0f0f0;"|'''Total''' |- | 1||V4 - gDNA||2.5||3.8||3||20.7||30 |- | 2||V4 - cDNA||2.5||3.8||3||20.7||30 |- | 3||V4 - NTC||2.5||0||3||24.5||30 |- | 4||V7 - gDNA||1||15||3||11||30 |- | 5||V7 - cDNA||1||15||3||11||30 |- | 6||V7 - NTC||1||0||3||26||30 |} '''Program'''<br> * 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h * -> add 3ul AmpLigase enzyme mix (0.5U/ul AmpLigase in 1X AmpLigase buffer) * -> 55 C 20h-> 94C 2min -> add 2ul Exo I/III mix-> 37C 2h -> 94C 2min -> 4C hold. *'''FORGOT TO ADD MINERAL OIL;''' added mineral oil after adding 3ul Ampligase mix ====AmpLigase enzyme mix==== {| class="wikitable" style="text-align:center;{{table}} border = 1 | align="center" style="background:#f0f0f0;"|'''Components''' | align="center" style="background:#f0f0f0;"|'''Stock conc.''' | align="center" style="background:#f0f0f0;"|'''Unit''' | align="center" style="background:#f0f0f0;"|'''Final conc.''' | align="center" style="background:#f0f0f0;"|'''Unit''' | align="center" style="background:#f0f0f0;"|'''Prepare volume 30ul''' |- | AmpLigase||5||U/ul||0.5||U/ul||2.00 |- | 10x AmpLigase Buffer||10||x||1||x||2.00 |- | H2O||||||||||16.00 |- | Total||||||||||20.00 |} ===Add Sequence Adapters PCR=== ====Primers==== {| {{table}} | align="center" style="background:#f0f0f0;"|'''Primer''' | align="center" style="background:#f0f0f0;"|'''Sequence''' | align="center" style="background:#f0f0f0;"|'''Index #''' |- | ISB_CA_AF||AATGATACGGCGACCACCGAGATCTACACGCCTGCATATCGGGAAGCTGAAG|| |- | ISB_CA_AR.T1||CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTGCCTTCCCGATATCCGACGG||Indx1 |- | ISB_CA_AR.T2||CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTGCCTTCCCGATATCCGACGG||Indx2 |- | ISB_CA_AR.T3||CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG||Indx3 |} {| {{table}} | align="center" style="background:#f0f0f0;"|'''Sample''' | align="center" style="background:#f0f0f0;"|'''Index''' | align="center" style="background:#f0f0f0;"|'''Forward Primer''' | align="center" style="background:#f0f0f0;"|'''Reverse Primer''' |- | 1||1||ISB_CA_AF||ISB_CA_AR.T1 |- | 2||2||ISB_CA_AF||ISB_CA_AR.T2 |- | 3||3||ISB_CA_AF||ISB_CA_AR.T3 |- | 4||1||ISB_CA_AF||ISB_CA_AR.T1 |- | 5||2||ISB_CA_AF||ISB_CA_AR.T2 |- | 6||3||ISB_CA_AF||ISB_CA_AR.T3 |} ====PCR Test==== {| {{table}} | align="center" style="background:#f0f0f0;"|'''Components''' | align="center" style="background:#f0f0f0;"|'''1X Volume''' | align="center" style="background:#f0f0f0;"|'''6.5X Volume''' |- | Captured template||1||0 |- | 10uM Forward Primer||0.4||2.6 |- | 10uM Reverse Primer||0.4||0 |- | 2X KAPA SYBG MM||12.5||81.25 |- | H2O||10.7||69.55 |- | Total||25||153.4 |} *Aliquot 23.6ul from 6.5X master mix and add 1ul captured template and 0.4ul corresponding reverse primer Program 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min [[File:012314_CA12kNov14_CaptureSequence_test.JPG | 650px]] *Looks good; NTC are both negative so I won't amplify on next PCR ====PCR==== {| {{table}} | align="center" style="background:#f0f0f0;"|'''Components''' | align="center" style="background:#f0f0f0;"|'''1X Volume''' | align="center" style="background:#f0f0f0;"|'''4.5X Volume''' |- | Captured template||12||0 |- | 10uM Forward Primer||2||9 |- | 10uM Reverse Primer||2||0 |- | 2X KAPA SYBG MM||50||225 |- | H2O||34||153 |- | Total||100||387 |} *Aliquot 86ul from 4.5X master mix and add 12ul captured template and 2ul corresponding reverse primer Program 98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x13 -> 72C 3min [[File:012614_CA12kNov14_CaptureSequencePCR.JPG|650px]] *Bead purification with 1.5:1 Beads to amplicon volume ratio **Eluted with 50ul total for each sample ===PAGE Quantification=== *Load 2ul of each sample + 2ul loading dye [[File:2015-01-28_CA12k_Nov2014_V4V7_SequenceQuant.jpg|650px]] *Sample1 (V4 - gDNA):40ng/ul *Sample2 (V4 - cDNA):41ng/ul *Sample4 (V7 - gDNA):10ng/ul *Sample5 (V7 - cDNA):12ng/ul [[Media:2015-01-28_CA12k_Nov2014_V4V7_SequenceQuant.xlsx | concentration calculations]]
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information