Editing
Rui:LabNotes/SingleCell/2013-7-31
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==mNPC plate with the latest version of hiMg-TSO and hiMg-IVT protocols== * The latest version of hiMg-TSO and hiMg-IVT protocols confirmed on 7/29/13 * I didn't use Betaine because it hasn't come in yet * mNPC plate was sorted on 7.10.13 in hiMg buffer [http://genome-tech.ucsd.edu/LabNotes/index.php/Blue:RNA-Seq_Experiments:07252013] * I only have 24 RL.T7.id01-24 with no VN * I also use 24 T20V.id01-24 for TSO or 2 step IVT ===Design=== [[File:7.31.13_mNPC-display.jpg]] [[File:7.31.13_mNPC-seq.jpg]] ===Procedures=== * 2ul Lysis: the long procedure originally used for fluidigm * 3ul PNK: 1mM ATP, RNase-In (1:2d), PNK (1:2d) * 4ul PAP: 1mM ATP, PAP (1:10d) * 10ul RT: 3ul 0.2uM T20.id01-24 or RL.T7.id01-24 * beads pools into 4 tubes, 3 column each (240ul beads + 240ul rec.) * TSO with TSO.r04 or TSO.r05 (LNA) * 2nd strand in 20ul * T7 addition for T20.id01-24 for 2 step IVT * beads purification * IVT in 20ul for 12 hrs * Directly take 2ul for a quick run (RT-PCR), purify the rest with Zymo kit * RT with N6 or N9 * QPCR for 12 cycles * Redo RT-PCR with adjusted aRNA input (3ul, 6ul, 6ul, 6ul from IVT-1,2,3,4) * The rest of aRNAs were store at -80C (Rui Cell (MEF) box) with label 8.1.13 IVT#1,2,3,4. * beads purification or size selection (if primer-dimer is an issue) ===Results=== *IVT-1: 24 SCs (RL.T7.id01-24), 1 step IVT, N6 RT-PCR, N2.id09 *IVT-2: 24 SCs (RL.T7.id01-24), 1 step IVT, N9 RT-PCR, N2.id10 *IVT-3: 12 SCs (T20.id01-24), 2 step IVT, N6 RT-PCR, N2.id11 *IVT-4: 12 SCs (T20.id01-24), 2 step IVT, N9 RT-PCR, N2.id12 *IVT-1: 12 SCs (T20.id01-24), TSO with TSO.r04, N2.id14 *IVT-2: 12 SCs (T20.id01-24), TSO with TSO.r05, N2.id15 [[File:8.1.13_IVT-TSO.jpg]] ===Libraries=== #IVT1: RL-hiMgIVT_N2id09-Aug1 #IVT2: RL-hiMgIVT_N2id10-Aug1 #IVT3: RL-hiMgIVT_N2id11-Aug1 #IVT4: RL-hiMgIVT_N2id12-Aug1 #TSO1: RL-hiMgTSO_N2id14-Aug1 #TSO2: RL-hiMgTSO_N2id15-Aug1 [[File:8.2.13_final check.jpg]] Read 1: [totoRNAseq Read 1 v2] CCACCGAGATCTACACTCTTTCCCTACACGACG Read 2: [N2 Read 2] Barcode read: *[N2Indseq] *[RL.T7.IndSeq] AAAAAAAAAAAAAAAAAAAAGCGGGCTGGCAAGG
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information