Editing
Dinh/Dinh 2013/NOTES/2013-6-24
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==Pre-processing== === Standard trimming + UMI === * Obtain UMI from the first 10bp of read 1, label both reads with UMI * Trim 27 bp from 5 prime end of read 1 and read 2 === Adapter removal with fastq-mcf === * Remove adapter sequences using fastq-mcf ? * Since the insert = (target_size= 200-280) + (2 arms ~ 64 bp) + (UMI = 10 bp) = 274-354bp, we would not have sequenced the adapters with just 250bp from each end. * Try removing adapters because mapping rate was ~40%. * Adapters: >Linker TTGGAGGCTCATCGTTCCTATTCAGGCAGATGTTATCGAGGTCCGAC >Linker_rev GTCGGACCTCGATAACATCTGCCTGAATAGGAACGATGAGCCTCCAA ===fastq-mcf results=== * Note that only R1 was end-trimmed using "Linker" and only R2 was end-trimmed using "Linker_rev" {| {{table}} | align="center" style="background:#f0f0f0;"|'''index''' | align="center" style="background:#f0f0f0;"|'''Total reads''' | align="center" style="background:#f0f0f0;"|'''Clipped 'end' reads''' | align="center" style="background:#f0f0f0;"|'''% clipped''' | align="center" style="background:#f0f0f0;"|'''Too short after clip''' | align="center" style="background:#f0f0f0;"|'''% too short''' |- | 1, R1||546,091||265,765||48.67%||16,468||3.02% |- | 1, R2||546,091||330,822||60.58%||16,112||2.95% |- | 2, R1||1,201,482||599,205||49.87%||46,756||3.89% |- | 2, R2||1,201,482||733,958||61.09%||45,880||3.82% |- | 3, R1||2,107,061||1,159,863||55.05%||30,221||1.43% |- | 3, R2||2,107,061||1,348,459||64.00%||29,076||1.38% |- | 4, R1||1,576,107||821,955||52.15%||16,478||1.05% |- | 4, R2||1,576,107||1,000,442||63.48%||16,703||1.06% |- | 5, R1||2,416,376||1,172,370||48.52%||30,785||1.27% |- | 5, R2||2,416,376||1,470,535||60.86%||29,880||1.24% |- | 6, R1||2,025,366||1,044,010||51.55%||17,056||0.84% |- | 6, R2||2,025,366||1,266,104||62.51%||16,306||0.81% |- | 7, R1||1,632,245||737,076||45.16%||12,924||0.79% |- | 7, R2||1,632,245||398,506||24.41%||12,788||0.78% |- | 8, R1||2,699,273||1,252,029||46.38%||24,410||0.90% |- | 8, R2||2,699,273||668,800||24.78%||22,635||0.84% |- | |} === Merge R1 and R2 with COPE === * Create kmer_table for COPE kmerfreq -k 17 -t 4 -c -1 -p kmer_table read.lst >kmerfreq.cout 2>kmerfreq.cerr * Use COPE to combine overlapping read 1 and read 2 <nowiki> for f in 1Index1_S1 1Index2_S2 1Index3_S3 2Index4_S6 1Index5_S4 2Index6_S7 2Index7_S8 1Index8_S5 do ./getUMI.pl 130620_MiSeq/TES1-${f}_L001_R1_001.fastq 130620_MiSeq/TES1-${f}_L001_R2_001.fastq $f ~/softwares/cope-src-v1.1.3/src/cope -a $f.R1.fq -b $f.R2.fq -o $f.fq -2 $f.leftR1.fq -3 $f.leftR2.fq -m 1 -t kmer_table.freq.cz -f kmer_table.freq.cz.len >cope.$f.log 2>cope.$f.error rm $f.R1.fq $f.R2.fq done </nowiki> ===COPE results=== * Without adapter removal: {| {{table}} border=1 | align="center" style="background:#f0f0f0;"|'''index''' | align="center" style="background:#f0f0f0;"|'''total_pairs''' | align="center" style="background:#f0f0f0;"|'''connected_pairs''' | align="center" style="background:#f0f0f0;"|'''connect_ratio(%)''' | align="center" style="background:#f0f0f0;"|'''low_quality_pairs''' | align="center" style="background:#f0f0f0;"|'''low_quality_ratio(%)''' |- | 1||546,091||37,624||6.88969||239413||43.8412 |- | 2||1,201,482||76,332||6.35315||603335||50.2159 |- | 3||2,107,061||120,889||5.73733||1155859||54.8565 |- | 5||2,416,376||157,448||6.51587||1124046||46.5178 |- | 8||2,699,273||191,332||7.08828||1138412||42.1748 |- | 4||1,576,107||100,314||6.36467||805229||51.0897 |- | 6||2,025,366||131,396||6.48752||990421||48.9008 |- | 7||546,091||35,800||6.55568||239459||43.8497 |} * With adapter (linker sequence) removal: {| {{table}} border=1 | align="center" style="background:#f0f0f0;"|'''index''' | align="center" style="background:#f0f0f0;"|'''total_pairs''' | align="center" style="background:#f0f0f0;"|'''connected_pairs''' | align="center" style="background:#f0f0f0;"|'''connect_ratio(%)''' | align="center" style="background:#f0f0f0;"|'''low_quality_pairs''' | align="center" style="background:#f0f0f0;"|'''low_quality_ratio(%)''' |- | 1||529623||20770||3.92166||195892||36.9871 |- | 2||1154726||42045||3.64112||477352||41.339 |- | 3||2076840||65820||3.16924||970053||46.7081 |- | 5||2385591||96387||4.04038||964834||40.4442 |- | 8||2674863||126170||4.71688||1012342||37.8465 |- | 4||1559629||55184||3.53828||684665||43.8992 |- | 6||2008310||76903||3.82924||820560||40.8582 |- | 7||1619321||80497||4.97103||584325||36.0846 |- | |}
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information