Editing
Chris:LabNotes/sci-Methyl Seq/Calendar/2017/2017-3-13
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==Barcode 1 Adapter Design== *This is from the Google Doc here <https://docs.google.com/document/d/1f6fUYy26eaqqJKdxxTBFgeVucB0uOuHPdfUKYiLDF9U/edit?usp=sharing> *From the previous experimental design, we see that Filler 1 is somewhat extraneous (there is nothing that is intended to bind to Filler 1), while Filler 2 must have a high enough Tm in order for Adapter 2 annealing later on in the protocol. **To simplify design, we will just remove Filler 1 from the adapter sequence for now (may want to add in later if we want to evaluate bisulfite treatment efficiency) *Filler 2 Tm should be ~58.8C-61.4C with a length of 20bp. These parameters are based on the P5/P7 sequences that are appropriate for KAPA library amplification. *Using Dan's script to generate primers (primergenerator.py), we generated several random Filler 2 sequences we could potentially use. For the version 1 of the design, we'll be using the following Filler 2 sequence: Sequence primerGenerator Tm OligoAnalyzer Tm Notes GTCCCTCCTACCCGGCGTTT 57.9 61.8 (58C) Only 4-base self-dimer *We also want to choose an appropriate Barcode 1 (using a 3-letter alphabet [AGT] in order to avoid confounding results. *Consequently, the following is the final version of the test of Adapter 1: 5β [Phos]CGTTAG[AGGTG]GTCCCTCCTACCCGGCGTTT 3β AADD[Barcode]------Filler 2---- **We want to try making the Adapter 1 into a double stranded adapter, which may be necessary for the T4 ligation to work (need a bigger footprint than the 2-base overhang left by MspI digestion). Consequently, we want to anneal the following complementary sequence to Adapter 1: 5β AAACGCCGGGTAGGAGGGACCACCTCTAA 3β **Initial tests without the dsDNA adapter resulted in no ligation.
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information