Editing
Dinh/Dinh 2013/NOTES/2013-10-7
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
== BLAST sequences to adapters, linkers, and primers== * Since these were not bisulfite converted, I use the original reads to blast. * Library free adapters/linkers/primers >AmpF6.3Sol AATGATACGGCGACCACCGACACTCT<b>CAGATGTTATCGAGGTCCGAC</b> >AmpR6.3Ind1 CAAGCAGAAGACGGCATACGAGATCGTGATGC<b>TAGGAACGATGAGCCTCCAA</b>C >SolSeqV6.3.2 ACCGACACTCT<b>CAGATGTTATCGAGGTCCGAC</b> >SolSeqV6.3.2r GC<b>TAGGAACGATGAGCCTCCAAC</b> >AmpR6.3IndSeq <b>GTTGGAGGCTCATCGTTCCTA</b>GC >AmpF6.4Sol AATGATACGGCGACCACCGAGATCTACACCACTCT<b>CAGATGTTATCGAGGTCCGAC</b> >SolSeqV6.3.3 TACACCACTCT<b>CAGATGTTATCGAGGTCCGAC</b> * BLAST args: $blastn -p blastn -d $db_file -K 100 -e 0.0001 -g F -F "m D" -a 4 -W 7 -m 8 -i $f -o $f.primers.blast * Number of reads mapped to library_free_primers: (BP - Blueprint sample, HM - HapMap sample NA12878, H1 - Human ESC H1) 590 BP1 667 BP2 458 BP1rep 812 BP2rep 222 BP1rep-hiseq 558 BP2rep-hiseq '''12''' HMrep1 (but this library has ~18.70% mapping rate??) '''5''' HMrep2 (but this library has ~15.07% mapping rate??) 505 HMrep3-hiseq '''23''' H1-dmr330K 279 HM-Miseq1 332 HM-Miseq2 * Number of hits to each primer sequences. NOTE: a read can hit multiple primer sequences. In parentheses are regions within primers which was hit 99% of the time. {| {{table}} border=1 | align="center" style="background:#f0f0f0;"|'''Sequencing Length''' | align="center" style="background:#f0f0f0;"|'''Sample''' | align="center" style="background:#f0f0f0;"|'''AmpF6.3Sol''' | align="center" style="background:#f0f0f0;"|'''AmpR6.3Ind1''' | align="center" style="background:#f0f0f0;"|'''SolSeqV6.3.2''' | align="center" style="background:#f0f0f0;"|'''SolSeqV6.3.2r''' | align="center" style="background:#f0f0f0;"|'''AmpR6.3IndSeq''' | align="center" style="background:#f0f0f0;"|'''AmpF6.4Sol''' | align="center" style="background:#f0f0f0;"|'''SolSeqV6.3.3''' |- | 250 || BP1||510 (27->47)||555 (53->33)||590 (12->32)||555 (23->3)||555 (1->21)||510 (36->56)||510 (12->32) |- | 250 || BP2||581||639||667||639||639||581||581 |- | 250 || BP1rep||363||444||458||444||444||363||363 |- | 250 || BP2rep||653||786||811||785||785||653||653 |- | 250 || HM-Miseq1 ||245||270||278||270||270||245||245 |- | 250 || HM-Miseq2 ||289||321||331||320||320||289||289 |- | 100 || BP1rep-hiseq||8||220||222||220||220||8||8 |- | 100 || BP2rep-hiseq||12||556||558||556||556||12||12 |- | 100 || HMrep3-hiseq||10||502||505||502||502||10||10 |- | 150 || H1-dmr330K||12||23||23||23||23||12||12 |- | 60 || HMrep1||0||5||5||5||5||0||0 |- | 60 || HMrep2||1||12||12||12||12||1||1 |} * The reads map to ONLY the adapter sequences. * Frequency of positions where the adapter mapped to reads: [[File:blueprint.blast.primers_positions.png]] ===Conclusions=== * Chimeric sequences were present in all except for the H1-dmr330k which was 124bp long after all the necessary trimmings. The samples sequenced in HL157 was only 35bp after trimming, which might affected the detection of the primer sequences. Since in the Hiseq run with 65bp, we can already start to see the the primer sequences, which was not present in the H1-dmr330k sample, there is significant mapping of reads to the adapter/linker/primer sequences with the Blueprint probes compared to the DMR330k probes.
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information