Editing
Arichard:Notebook/2013/June
(section)
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
====Quartz-Seq Protocol for 500 pg Agilent UHRR, 2 samples==== * Work in the PCR hood * Keep enzyme stocks in cold box * Mix reactions on cold rack * Use UV treated Ambion RNase/DNase free water * Use UV treated 0.5 and 1.5 ml Eppendorf Lo-Bind tubes * Use UV treated 0.2 ml Axygen Cat# 22-154LR low retention tubes Sequences used in Quartz protocol: {| {{table}} | align="center" style="background:#f0f0f0;"|'''Name''' | align="center" style="background:#f0f0f0;"|'''Sequence''' |- | RT primer||TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT |- | Tagging primer||TATAGAATTCGCGGCCGCTCGCGATTTTTTTTTTTTTTTTTTTTTTTT |- | Suppression PCR primer||GTATAGAATTCGCGGCCGCTCGCGAT |- | |} * UHRR/ERCC mix: 2.5 ul 500 pg/ul UHRR 2.5 ul 1:1e4 ERCC 14 ul H2O -------------- Total = 19 ul * RT annealing mix: 3 ul 10X Titanium Taq buffer 3 ul 1 mM dNTPs 3 ul 0.833 uM RT primer 2 ul RNasin Plus 19 ul UHRR/ERCC mix ---------------------------- Total = 30 ul * RT rxn mix: 2 ul 10X Titanium Taq buffer 13 ul H2O 2.5 ul 0.1 M DTT 2.5 ul SuperScript III ----------------------------- Total = 20 ul * RT annealing rxn: 12 ul RT priming buffer (Quartz seq adds this to beads, but we are using purified reference RNA in the priming buffer) --------------------------------------------------------------------------------------------------- Total = 12 ul # 1 min @ RT # 90 sec @ 70 degC # 15 sec @ 35 degC # Hold @ 4 degC * RT rxn: 12 ul RT annealing rxn 8 ul RT rxn mix ---------------------- Total = 20 ul # 5 min @ 35 degC # 20 min @ 45 degC # 10 min @ 70 degC # Hold at 4 degC # Prepare Exo I mix * Exo I mix: 2 ul 10X Titanium Taq buffer 1 ul 10X Exo III buffer 1 ul 0.1 M DTT 3 ul Exo I 23 ul H2O ----------------------------- Total = 30 ul * RT primer removal: ** 20 ul RT rxn ** 36 ul Ampure RNAClean XP ** Total = 56 ul # 10 min @ RT # 5 min on magnet # Wash 2x with 1 min with 50 ul 80% EtOH # Dry 3 min # Add 6 ul Exo I mix # 1 min @ RT # 5 min on magnet # Transfer to new tube # 30 min @ 37 degC # 20 min @ 80 degC # Hold @ 4 degC * PolyA mix: 1 ul 10X Titanium Taq buffer 1.5 ul 20 mM dATP (dilute 100 mM dATP 1:5) 1.2 ul 1:5 RNase H 0.84 ul TdT (Roche) 5.46 ul H2O ------------------------------------------ Total = 10 ul * PolyA rxn: 6 ul Exo I rxn 5 ul PolyA mix -------------- Total = 11 ul # 50 sec @ 37 degC # 10 min @ 65 degC # Hold @ 4 degC * 2nd strand mix: 78.25 ul 2x Terra buffer 1 ul 10 uM Tagging primer 6.25 ul Terra polymerase 58.75 ul H2O ------------------------- Total = 144.25 ul * 2nd strand rxn: 11 ul PolyA rxn 46 ul 2nd strand mix -------------------- Total = 57 ul # 10 sec @ 98 degC # 1 min @ 40 degC # 5 min @ 68 degC # Hold @ 4 degC # Move to cold rack ---------------------------------- * PCR mix (Clontech): 21.1 ul 2x Terra 1 ul 100 uM SuppressPCR primer 25.25 ul H2O ------------------------------ Total = 52.33 ul * PCR mix (KAPA): 21.1 ul 2x HiFi U+ 1 ul 100 uM SuppressPCR primer 25.25 ul H2O ------------------------------ Total = 52.33 ul * PCR rxn: 57 ul 2nd strand rxn 50 ul PCR mix --------------------- Total = 107 ul * Clontech protocol: # Preheat, 10 sec @ 68 deg # 15 cycles: ## 10 sec @ 98 degC ## 15 sec @ 65 degC ## 5 min @ 68 degC # 5 min @ 68 degC # Hold @ 4 degC * KAPA protocol # 5 min @ 95 degC # 15 cycles: ## 20 sec @ 98 degC ## 15 sec @ 65 degC ## 5 min @ 72 degC # 5 min @ 72 degC # Hold @ 4 degC ---------------------------------- * Store @ -80 degC until library prep
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information