Editing
AlanFung:LabNotes/ASE/2010/2010-7-26
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==RNA allelotyping on hybrids== ===Exp. #1 Perform CES36k capturing experiment on double stranded cDNAs=== *Samples: *Samples: **A: 1000-somatic: 61.9ng/ul x 15ul **B: 1000-iPS: 87.8ng/ul x 15ul **C: 1034-iPS: 53.5ng/ul x 15ul **D: A2: 49.7ng/ul x 15ul **E: B4: 44.8ng/ul x 15ul **F: 1016-somatic: 58.1ng/ul x 15ul **G: 1016-iPS: 60.6ng/ul x 15ul **H: B5-iPS: 55.5ng/ul x 15ul **BJ: 27.2ng/ul x 15ul **HUES6: 40.9ng/ul x 15ul *Probes: CES36k18bp, 590nM (prepared by Kun on 7/16/2010) *Target:Probe ratio=200. With 200ng cDNA template, we need 1.4ul of probes. ---- {| {{table}} | Sample||ng/ul||Template||Probes||10X Buffer||H2O |- | A||61.9||3.23||1.4||1||4.37 |- | B||87.8||2.28||1.4||1||5.32 |- | C||53.5||3.74||1.4||1||3.86 |- | D||49.7||4.02||1.4||1||3.58 |- | E||44.8||4.46||1.4||1||3.14 |- | F||58.1||3.44||1.4||1||4.16 |- | G||60.6||3.3||1.4||1||4.3 |- | H||55.5||3.6||1.4||1||4 |- | BJ||27.2||7.35||1.4||1||0.25 |- | HUES6||40.9||4.89||1.4||1||2.71 |- | |} *Add in two drops of mineral oil using P200 pipette *Spin down Saved under Kun KZ-S-MIP 95c 30sec -> cool down to 60C at 0.1C/sec -> 60C 20h -> add 1ul SLN mix(2U/ul AmpliTaq Stoffel fragment; 0.5U/ul AmpLigase; 50uM dNTP) -> 60C 20h-> 94C 2min -> add 1ul Exo I/III mix-> 37C 1h -> 94C 2min -> 4C hold. PCR 2X iProof Mastermix 50ul AmpF6.3NH2 (100uM) 0.2ul AmpR6.3NH2 (100uM) 0.2ul 50X SYBG I 0.4ul H2O 40ul Captured DNA 10ul {| {{table}} | ||X11 |- | 2X iProof Mastermix||550 |- | AmpF6.3NH2 (100uM)||2.2 |- | AmpR6.3NH2 (100uM)||2.2 |- | 50X SYBG I||4.4 |- | h2o||440 |- | |} 98C 30S -> (98C 10S -> 58C 20S -> 72C 20S) x 20 Monitoring the reactions and terminate the program right before the amplification curves reach the plateau. Purified with Qiaquick columns, quantified with Nanodrop: (A) 6.1ng/ul x 40ul (B) 9.3ng/ul x 40ul (C) 8.4ng/ul x 40ul (D) 7.7ng/ul x 40ul (E) 7.4ng/ul x 40ul (F) 6.0ng/ul x 40ul (G) 4.6ng/ul x 40ul (H) 6.1ng/ul x 40ul (Hues6)6.4ng/ul x 40ul (BJ)13.5ng/ul x 40ul [[File:ZhangLab_2 2010-07-30 12hr 45min.jpg|300px]] **E-gel size Selection for BJ [[File:ZhangLab_2 2010-07-30 16hr 03min.jpg|300px]] *Set up 2nd round PCR to add barcodes. **Forward primers: AmpF6.3Sol: AATGATACGGCGACCACCGACACTCTCAGATGTTATCGAGGTCCGAC **Reverse primers: Sample ID Primer ID Bardcode (rev. comp.) (A) AmpR6.3Ind1 (B) AmpR6.3Ind2 (C) AmpR6.3Ind3 (D) AmpR6.3Ind4 (E) AmpR6.3Ind5 (F) AmpR6.3Ind6 (G) AmpR6.3Ind7 (H) AmpR6.3Ind8 (Hues6) AmpR6.3Ind9 (BJ) AmpR6.3Ind10 PCR x 8 Template: 4ul 2x Kapa SYBG qPCR Master Mix: 50ul 100uM AmpF6.3Sol: 0.4ul 100uM AmpR6.3IndXX: 0.4ul H2O 46ul {| {{table}} | PCR||1||X11 |- | 2X Kapa SYBG qPCR Master Mix||50||550 |- | 100uM AmpF6.3Sol||0.4||4.4 |- | H20||46||506 |- | |} 95C 30sec -> (95C 3sec -> 60C 20sec) x 5 -> 60C 1min Purified with Qiaquick columns, quantified with Nanodrop, and pooled in equal ratios. Sample A: 17.4ng/ul x 40ul B: 28.3ng/ul x 40ul C: 24.7ng/ul x 40ul D: 22.1ng/ul x 40ul E: 21.2ng/ul x 40ul F: 20.2ng/ul x 40ul G: 16.7ng/ul x 40ul H: 16.9ng/ul x 40ul Hues6: 20.7ng/ul x 40ul BJ: 17.9ng/ul x 40ul {| {{table}} | ||ng/ul||To get 100ng (ul)|| |- | A||17.4||5.75|| |- | B||28.3||3.53|| |- | C||24.7||4.05|| |- | D||22.1||4.52|| |- | E||21.1||4.74|| |- | F||20.2||4.95|| |- | G||16.7||5.99|| |- | H||16.9||5.92|| |- | Hues6||20.7||4.83|| |- | BJ||17.9||5.59|| |- | Total Volume||||49.87|| |- | Concentration||||||20ng/ul |- | |} **Size Selection
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Template used on this page:
Template:Table
(
edit
)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information