Editing
AlanFung:LabNotes/EZ/2009-3-23
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
='''EZ DNA Methylation Direct-GM20431 100 & 10 cells'''= ==Objective== *Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells. *Repeat with same conditon asprevious 100 cells DNA Methylation to try to get the CHR8 primer to work. ==Samples & Materials== *GM20431 cells *EZ DNA Methylation Direct Kit 03/11/09 *Primers - From IDT -------------------------------------------------- 0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG 0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA 0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT 0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA 0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT 0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA -------------------------------------------------- *Creating 100uM primer 0.1_F_chr22 27.9nmol RNAse free H2O 279uL 0.1_R_chr22 31.8nmol RNAse free H2O 318uL 0.8_F_chr21 31.30nmol RNAse free H2O 313uL 0.8_R_chr21 31.70nmol RNAse free H2O 317uL 0.9_F_chr8 30.10nmol RNAse free H2O 301uL 0.9_R_chr8 29.30nmol RNAse free H2O 293uL ------------------------------ *Making 3.3uM primer working solution Dilute 33uL 100uM primer with 967uL RNAse free H2O *Jurkat gDNA (100ug/mL) *Dilute 1uL stock gDNA with 99uL RNAse-free H20 *Agarose Gel ==Overview== *Cell Preparation *Bisulfite Conversion *PCR amplification *Agarose Gel Electrophoresis ==Procedures== *Turn on the incubator heat it up to 50C *Cell Preparation Resuspended cells in T25 flask by repeat pipetting Perform cell counting *Cell Count of GM20431 P20: 144,969 cells/mL To get 1,000,000 cells: 1,000,000/(144,969cells/mL)=6.898mL aspirate 6mL + 898uL cell suspension and transfer to a 50mL centrifuge tube Spin down at 10,000 rpm for 5 mins Aspirate supernatant completely Resuspended cells with 1000uL UV treated PBS (1000cells/uL) *Cell Dilution Performed cell dilution to reach concentration of 11.11 cells/uL and 1.11 cells/uL *111.11 cells/uL Dilute 10uL (1000cells/uL)cell suspension with 80uL UV treated PBS *11.11 cells/uL Dilute 10uL (111.11 cells/uL) cell suspension with 90 uL UV treated PBS *1.11 cells/uL Dilute 10uL (11.11 cells/uL) cell suspension with 90 uL UV treated PBS *Sample Digestion with Proteinase K 1rxn x 2 -------------------------------------------- RNAse-free H2O 0.0 0.0 Protinase K 1.0 1.0 M-Digestion Buffer (2X) 10.0 10.0 -------------------------------------------- Mix by repeat pipetting 111.11 cells/uL 9.0 11.11 cells/uL 9.0 --------------------------------------------- 20uL 20uL Incubate the samples at 50C for 20 mins *Bisulfite Conversion of DNA Add in 130uL of CT conversion Reagent Solution into a labeled PCR tube Extract 20uL of sample supernatant Mix by repeat pipetting Centrifuge briefly to ensure no droplets are in the cap or side of the tube Perform reaction in thermocycler Step1 98C, 8m Step2 64C, 3.5hr Step4 4C, storage for up to 20 hr Add 600uL of M-Bindin Buffer into a IC Column and place column into a collection tube Load samples into IC column CLOSE CAP AND MIX BY INVERTING THE COLUMN SEVERAL TIMES Centrifuge at (max speed) 20,000g for 30s Discard flow through Add 100uL M-Wash Buffer to column Repeat Centrifuge Add 200uL of M-Desulphonation Buffer to column let stand at RT for 20m Repeat centrifuge step Add 200uL of M-Wash Buffer to the column Repeat Centrifuge Repeat washing step Place column in a 1.5mL tube Add in 10uL of M-Elution Buffer directly to the column matix Repeat Centrifuge *PCR Sample A 100 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 0.5 0.5 0.5 RNAse free H20 7.5 7.5 7.5 ------------------------------------------------- Total 40uL Sample B 10 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 0.5 0.5 0.5 RNAse free H20 7.5 7.5 7.5 ------------------------------------------------- Total 40uL A-CHR22 F/R B-CHR21 F/R C-CHR8 F/R Perform PCR reaction in thermocycler Step1 96C, 3m Step2 95C, 30s Step3 62C, 1m Step4 72C, 1m Step5 Go to step2 repeat 39 times Step6 72C, 5m Step7 4C, Forever *Gel Electrophoresis Gel 1 Well 1 2 3 4 5 6 7 8 ----------------------------------------------------------------- Content Blank AA AB AC BA BB BC Ladder Sample 0 10 10 10 10 10 10 3 6X Loading Dye 0 2 2 2 2 2 2 3 ----------------------------------------------------------------- Total 14uL 9uL *Run gel at 135 V for 20 min. ==Results== [[Image:ZhangLab_2 2009-03-24 11hr 46min_crop.jpg]] *No bands showed up for the 10 cells methylation at all *Only CHR22 and CHR21 primers showed up for 100 cells methylation, result is the same as previous experiment ==Suggestion== Increase 0.5uL gDNA template to 10uL
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information