Editing
Daniel:Notebook/ComboLock/2016-8-5
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
=Positive Control Amplicon Production= [[Daniel:Notebook/ComboLock|Back to Calendar]] In order to test the latch-padlock binding better, I am going to use a positive control oligonucleotide. The oligo is designed to contain only the parts of the C probes (and antibody oligos) that bind to the latch and padlock, as well as barcodes. The oligos will also have biotin, which means I'll have a good method for pulldown. ==Oligonucleotide Design== First thing is to design the oligos. The following table indicates the created oligonucleotide sequences. The LatchX1, C1 amplicon and C2 amplicon were ordered from IDT. The reason for the additional latch is to remove the UMI on the normal latch sequences. Since the UMI is a degenerate sequence I can't design an oligo to bind to it. Therefore I replaced the UMI on the normal latch sequences with a second barcode for the LatchX1 probe. There are two amplicons because IDT doesn't allow you to attach a biotin to ultramers (>60 bp). {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8</hiddentext> |- style="background-color:#B7DEE8;font-size:12pt;font-weight:bold" align="center" | width="93" height="15" | Name | width="274" | Sequence | width="256" | Reverse Complement | width="65" | Length (bp) | width="183" | Components |- style="font-size:12pt" valign="bottom" | height="15" | primer2 | ACGGCGGACCTCGCACGG | CCGTGCGAGGTCCGCCGT | align="center" | 18 | align="center" | |- style="background-color:#D9D9D9;font-size:12pt" valign="bottom" | height="15" | primer4 | CCGTGGACGGTCGCGTTC | GAACGCGACCGTCCACGG | align="center" | 18 | align="center" | |- style="font-size:12pt" valign="bottom" | height="15" | primer6 | CGGCGATGCGTGATCGGG | CCCGATCACGCATCGCCG | align="center" | 18 | align="center" | |- style="background-color:#D9D9D9;font-size:12pt" valign="bottom" | height="15" | primer12 | CCCGCCCAGTAACCGGCG | CGCCGGTTACTGGGCGGG | align="center" | 18 | align="center" | |- style="font-size:12pt" valign="bottom" | height="15" | LatchX1 Barcode | CATTTAGTATACGGGC | GCCCGTATACTAAATG | align="center" | 16 | align="center" | |- style="background-color:#D9D9D9;font-size:12pt" valign="bottom" | height="15" | Latch 8 barcode | TATTTGTA | TACAAATA | align="center" | 8 | align="center" | |- style="font-size:12pt" valign="bottom" | height="15" | Latch 9 barcode | GCGCCTAC | GTAGGCGC | align="center" | 8 | align="center" | |- style="background-color:#D9D9D9;font-size:12pt" valign="bottom" | height="45" | Total Amplicon | ACGGCGGACCTCGCACGGTATTT GTACCGTGGACGGTCGCGTTCGCCCGTATAC TAAATGCGGCGATGCGTGATCGGGGCG CCTACCCCGCCCAGTAACCGGCG | CGCCGGTTACTGGGCGGGGTAGG CGCCCCGATCACGCATCGCCGCATTTAGTAT ACGGGCGAACGCGACCGTCCACGGTAC AAATACCGTGCGAGGTCCGCCGT | align="center" | 104 | Primer2-Latch8BC-Primer4-LatchX1BCRevComp-Primer6-Latch9BC-Primer12 |- style="font-size:12pt" valign="bottom" | height="30" | C1 Amplicon | ACGGCGGACCTCGCACGGTATTTGTACCGTGGACGGTCGCGTTCACTAAATG | CATTTAGTGAACGCGACCGTCCACGGTACAAATACCGTGCGAGGTCCGCCGT | align="center" | 52 | align="center" | |- style="background-color:#D9D9D9;font-size:12pt" valign="bottom" | height="30" | C2 Amplicon | GCCCGTATCGGCGATGCGTGATCGGGGCGCCTACCCCGCCCAGTAACCGGCG | CGCCGGTTACTGGGCGGGGTAGGCGCCCCGATCACGCATCGCCGATACGGGC | align="center" | 52 | align="center" | |- style="font-size:12pt" valign="bottom" | height="30" | Latch X1 | CAAGATCATAAGAGTTCGTTCGTCCACCACACAGCGACGAGACCG | CGGTCTCGTCGCTGTGTGGTGGACGAACGAACTCTTATGATCTTG | align="center" | 45 | primer6RC-bclp0001-bclp0002-primer4RC |} ==Ligation Reaction== Since the amplicon is in pieces right now, I need to ligate the C1 and C2 amplicons together. ===Theory=== C1 Amplicon: 5ACGGCGGACCTCGCACGGTATTTGTACCGTGGACGGTCGCGTTCACTAAATG3 C2 Amplicon: 5GCCCGTATCGGCGATGCGTGATCGGGGCGCCTACCCCGCCCAGTAACCGGCG/Biotin/3 LatchX1: 5CAAGATCATAAGAGTTCGTTCGTCCACCACACAGCGACGAGACCG3 '''Update: LatchX1 was a misorder. I need to use Latch X2 instead''' LatchX2: 5CCCGATCACGCATCGCCGATACGGGCCATTTAGTGAACGCGACCGTCCACGG3 Reaction Trimer: LX2 C1|C2 3GGCACCTGCCAGCGCAAGTGATTTAC|CGGGCATAGCCGCTACGCACTAGCCC5 ACGGCGGACCTCGCACGGTATTTGTACCGTGGACGGTCGCGTTCACTAAATG|GCCCGTATCGGCGATGCGTGATCGGGGCGCCTACCCCGCCCAGTAACCGGCG/Biotin/ [[Category:ComboLock]] [[Category:20160805]]
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information