Editing
Daniel:Notebook/RNAFISH/2014-7-7
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
=Probe Design= [[Daniel:Notebook/RNAFISH|Back to Calendar]] Designing probes for Matt and Hosuk's rolony project. The three genes they are testing are ACTB, RAB7A, and MALAT1. I will design probe sets for these three genes. ==Workflow== #Obtain transcript sequence from [http://genome.ucsc.edu/|UCSC Genome Browser] ##Use genome browser to find genes, and tables to download transcript (mRNA only) #Use gene sequence as input for [https://www.biosearchtech.com/stellarisdesigner/|Stellaris probe designer] ##Designer created by Arjun Raj, utilized by Long Cai for paper ##Creates 20mer probes #Copy/paste probe sequences into .txt file #Print only sequence to the oligo file ##awk '{print $2}' malat1_probes.txt > oligos_malat1.txt #Attach primer sequences before/after ##VI command, forward: :%s!^!GTCATATCGGTCACTGTT! ##VI command, reverse: :g/$/norm AGATCAGGATACACACTACCC ##Primer sequences are AP1 and AP2 from the V6 set, used in High Resolution Chromosome Painting ==Price Comparison IDT and Stellaris== {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8</hiddentext> |- style="background-color:#C5D9F1;font-size:12pt" | align="center" width="141" height="30" valign="bottom" | |style="font-weight:bold" width="56" align="center" valign="bottom" | IDT Primers |style="font-weight:bold" width="83" align="center" valign="bottom" | IDT Fluorophores |style="font-weight:bold" width="65" align="center" valign="bottom" | Stellaris |- style="font-size:12pt" | height="15" valign="bottom" | Length | align="center" align="center" valign="bottom" | 58 | align="center" align="center" valign="bottom" | 20 | align="center" align="center" valign="bottom" | 20 |- style="background-color:#D9D9D9;font-size:12pt" | height="15" valign="bottom" | Number of Oligos | align="center" align="center" valign="bottom" | 93 | align="center" align="center" valign="bottom" | 93 | align="center" align="center" valign="bottom" | 93 |- style="font-size:12pt" | height="15" valign="bottom" | Price/Base (100 nmol, USD) | align="center" align="center" valign="bottom" | 0.28 | align="center" align="center" valign="bottom" | 0.28 | align="center" valign="bottom" | NA |- style="background-color:#D9D9D9;font-size:12pt" | height="15" valign="bottom" | Modifications | align="center" valign="bottom" | None | align="center" valign="bottom" | Fluorophore | align="center" valign="bottom" | Fluorophore |- style="font-size:12pt" | height="15" valign="bottom" | Oligo Price | align="center" align="center" valign="bottom" | 1510.32 | align="center" align="center" valign="bottom" | 520.8 | align="center" align="center" valign="bottom" | 1725 |- style="background-color:#D9D9D9;font-size:12pt" | height="15" valign="bottom" | Modifications | align="center" align="center" valign="bottom" | 0 | align="center" align="center" valign="bottom" | 85 | align="center" align="center" valign="bottom" | 0 |- style="font-size:12pt" | height="15" valign="bottom" | Total Price |style="font-weight:bold" align="center" align="center" valign="bottom" | 1510.32 |style="font-weight:bold" align="center" align="center" valign="bottom" | 44268 |style="font-weight:bold" align="center" align="center" valign="bottom" | 1725 |} It would appear Stellaris can do this pretty cheap. However, one thing to keep in mind is that the oligos from Stellaris will not be renewable, and so once I use up all the probe I'll have to order again. Oligos from IDT with primer sequences will be renewable, but I'll have to do processing on them.
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information