Editing
Dinh 2011/NOTES/2011-11-21
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==5fc/5caC antibody DIP-seq== ===Reads mapping to repeats=== *continued from [[Dinh 2011/NOTES/2011-11-14]] *Unix sort of repeatTags and then using samtool's rmdup awk '{if($1 !~ /SQ/ && $1 !~ /PN/) print $0}' 5fC.repeatTags.sam | sort -k3,3 -k4,4n | samtools view -uSt ../../mm9Annotations-iGenomeUCSC/BWAIndex/genome.fai - | samtools rmdup - rmdup.tmp samtools view rmdup.tmp > 5fC.repeatTags.rmdup.sam awk '{if($1 !~ /SQ/ && $1 !~ /PN/) print $0}' 5caC.repeatTags.sam | sort -k3,3 -k4,4n | samtools view -uSt ../../mm9Annotations-iGenomeUCSC/BWAIndex/genome.fai - | samtools rmdup - rmdup.tmp samtools view rmdup.tmp > 5caC.repeatTags.rmdup.sam awk '{if($1 !~ /SQ/ && $1 !~ /PN/) print $0}' IgG.repeatTags.sam | sort -k3,3 -k4,4n | samtools view -uSt ../../mm9Annotations-iGenomeUCSC/BWAIndex/genome.fai - | samtools rmdup - rmdup.tmp samtools view rmdup.tmp > IgG.repeatTags.rmdup.sam awk '{if($1 !~ /SQ/ && $1 !~ /PN/) print $0}' Input.repeatTags.sam | sort -k3,3 -k4,4n | samtools view -uSt ../../mm9Annotations-iGenomeUCSC/BWAIndex/genome.fai - | samtools rmdup - rmdup.tmp samtools view rmdup.tmp > Input.repeatTags.rmdup.sam *Number of tags after removing clonal tags (remember these are 'tags' and not reads because there can be multiple entries for the same reads) 19137939 5caC.repeatTags.rmdup.sam 4854260 5fC.repeatTags.rmdup.sam 4078937 IgG.repeatTags.rmdup.sam 6198027 Input.repeatTags.rmdup.sam *Random sorting and rebalancing the tags (macs14 will do some additional filtering, but at least the number of tags will be close): sort -R 5caC.repeatTags.rmdup.sam | head -4078937 > sampled.5caC.repeatTags.rmdup.sam sort -R 5fC.repeatTags.rmdup.sam | head -4078937 > sampled.5fC.repeatTags.rmdup.sam sort -R Input.repeatTags.rmdup.sam | head -4078937 > sampled.Input.repeatTags.rmdup.sam *Running macs14 in parallel: nohup macs14 -t sampled.5caC.repeatTags.rmdup.sam -c sampled.Input.repeatTags.rmdup.sam -f SAM -g mm -n 5caC-vsInput -w --call-subpeaks > macs14_5caCvsInput_balanced & nohup macs14 -t sampled.5fC.repeatTags.rmdup.sam -c IgG.repeatTags.rmdup.sam -f SAM -g mm -n 5fC-vsIgG -w --call-subpeaks > macs14_5fCvsIgG_balanced & nohup macs14 -t sampled.5caC.repeatTags.rmdup.sam -c IgG.repeatTags.rmdup.sam -f SAM -g mm -n 5caC-vsIgG -w --call-subpeaks > macs14_5caCvsIgG_balanced & nohup macs14 -t sampled.5fC.repeatTags.rmdup.sam -c sampled.Input.repeatTags.rmdup.sam -f SAM -g mm -n 5fC-vsInput -w --call-subpeaks > macs14_5fCvsInput_balanced & *Somehow, macs14 is still filtered out a lot of reads from each file, so I checked the *.rmdup.sam files and found that some clonal reads were not removed by rmdup: Clonal tags which remained in rmdup: HWI-EAS540-C:4:10:19388:9721#0:alt1 16 chr1 3005965 0 40M * 0 0 CAAAACAACCCTGAGATTCCACTTCACTCCAGTGAGAATG HHHHHHHHHGGGGGGGGFGGHHEHHHHHHHGGDGGA;;>@ NM:i:0 HWI-EAS540-C:4:50:7522:17537#0:alt1 16 chr1 3005965 0 40M * 0 0 CAAAACAACCCTGAGATTCCACTTCACTCCAGTGAGAATG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIGE?DBE NM:i:0 HWI-EAS540-C:4:58:3882:4518#0:alt1 16 chr1 3022945 0 40M * 0 0 AAAAACAATCTACAGATTCAATGAAATCCCCATCAAAATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGGGGG NM:i:0 HWI-EAS540-C:4:74:3471:6745#0:alt1 16 chr1 3022945 0 40M * 0 0 AAAAACAATCTACAGATTCAATGAAATCCCCATCAAAATT IIIIIIIIIIIIIIIIHIIIIIIHIIIIIIIIIIIGGGGG NM:i:0
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information