Editing
Hosuk:LabNotes/2013-12-30
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
*[[Hosuk:Lab_Notes|LabNote]] ===RT primer annealing specific position in mRNA=== ====Primer Design==== *Target gene : RAB7A *RAB7A mRNA target sequence: CAGAACTTGGACCTTCTCGCTTCTGTCCTCCGTTTAGTCTCCTC **This is base 125-177 *Choose primers that are 10bp long while minimizing GC content and ~200bp, ~300bp, ~500bp, and ~1000bp from TSS *mRNA target of RAB7A 220b distance from TSS : CGCGTTTGAA *mRNA target of RAB7A 300b distance from TSS : ACTCATGAAC *mRNA target of RAB7A 510b distance from TSS : CAACACATTC *mRNA target of RAB7A 1000b distance from TSS: TTACACCCCA *RT_RAB7A_220b: [/5Phos/TCTCGGGAACGCTGAAGA] + TTCAAACGCG (--> D220) *RT_RAB7A_300b: [/5Phos/TCTCGGGAACGCTGAAGA] + GTTCATGAGT (--> D300) *RT_RAB7A_510b: [/5Phos/TCTCGGGAACGCTGAAGA] + GAATGTGTTG (--> D510) *RT_RAB7A_1000b: [/5Phos/TCTCGGGAACGCTGAAGA] + TGGGGTGTAA(--> D1000) ====Rolony Fab.==== *Use 96 well plate (12/28~12/30) **Control : Random Hexamer [[File:PGP1F_96well_RTpositionTest_Cells_2.png|450px]] ====Result==== *Rolonies from 1000b primer were too many, they are much more than control (random hexamer). *There is a trend, 220b and 300b primer sample don't have many rolonies which are almost similar number that we've seen so far with RAB7A detection. *However 500b sample showed more rolonies, and 1000b sample has too many and too much strong signal. *I'm not sure the signal from 1000b sample is real signal or something other things...because it's too much. *But since I've made 4 wells per each sample, and all 4 wells have the sample result per each primer, so I think these images shows some meaningful results. *Raw images : [[Media:MIP_RTPrimer_RAB7A_C3_Hexamer-1_Step1_Pos1.tif|Control]], [[Media:MIP_RTPrimer_RAB7A_D3_D220-1_Step1_Pos1.tif|D220]], [[Media:MIP_RTPrimer_RAB7A_D7_D300-1_Step1_Pos1.tif|D300]], [[Media:MIP_RTPrimer_RAB7A_E3_D510-1_Step1_Pos1.tif|D510]], [[Media:MIP_RTPrimer_RAB7A_E7_D1000-1_Step1_Pos1.tif|D1000]] *[[File:MIP_RTPrimer_1stRolony_Compare.png|800px]] *1st Rolony Counts [[File:PGP1F_96well_RTpositionTest_1stRolonyCount.png|800px]] *PISA parameters **Gaussian Std : 3 **Gaussian Upper : -2e-4 **area upper: 50 **area lower: 4 **axratio lower: 0.6 **circ upper: 1.6 **circ lower: 0.8 **perim conn: 8 **bkgmult lower: 4 ====Result : RAB7A Target on 1st Rolony==== *ATTO550-RAB7A on 1st Rolony probes : '''NO signal at all! WHY?''' **I annealed Cy3 1st Rolony probes : showed the same signals to the previous Cy5 1st Rolony probes… so there are still 1st Rolonies…BUT then why there are no 1st Rolonies with RAB7A targets?
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information