Editing
Hosuk:LabNotes/2013-9-12
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
*[[Hosuk:Lab_Notes|LabNote]] ===Gene decoding with Barcoded Padlock probes=== ====Experimental plan==== *Hybridizing padlock probes on 1st rolonies, and *Generate 2nd rolonies over 1st rolonies, and *Observe each different fluorescent signal from 2nd rolonies ====Procedure==== *Prepare two barcoded padlock probes - ACTB, RAB7A =====Padlock probe for ACTB===== *'''ppACTB''' : /5Phos/CTGTGCTCGCGGGGCG CTTCAGCTTCCCGATATC CGACGG ACGTATCGGTAGTCGCAACGCA GGCAAAGGCGAGGCT --> 77bp **two arms : CTGTGCTCGCGGGGCG, GGCAAAGGCGAGGCT **site for decoding probes (dcProbe0-Cy3) : ACGTATCGGTAGTCGCAACGCA --> 22bp **site for 2nd RCA probes : CTTCAGCTTCCCGATATC --> 18bp =====Padlock probe for RAB7A===== *'''ppRAB7A''' : /5Phos/GAAGCGAGAAGGTCCAAGTTCTG CTTCAGCTTCCCGATATC CGACGG GTCTTGCGTGCGATACGGAGTA GAGGAGACTAAACGGAGGACA --> 90bp **two arms : GAAGCGAGAAGGTCCAAGTTCTG, GAGGAGACTAAACGGAGGACA **site for decoding probes (dcProbe1-Cy3) : GTCTTGCGTGCGATACGGAGTA --> 22bp **site for 2nd RCA probes : CTTCAGCTTCCCGATATC --> 18bp =====2nd RCA probe===== *'''FISSEQ_ppRCA''' : GATATCGGGAAGCTGA*A*G --> 18bp ====Overall Process==== #Prepare each probes β the concentration of each probes are resuspended to 200uM for each ACTB, RAB7A and 2nd RCA primer. #Hybridize Padlock probe β mixture: 1uL ACTB + 1uL RAB7A + 98uL 2x SSC #Add mix, and incubate dish in the oven at 55C for 1hr. #Prepare Ampligase mix - 1uL AmpLigase + 10uL Buffer + 89uL H2O #Aspirate PBS in rolony sample and wash with PBS once #Add AmpLigase mix to sample dish, and incubate in the oven at 45C for 4hr. #Run 2nd RCA from Padlock probes #* Pre-anneal RCA primer (2uL of 100uM in 98uL 2x SSC) 60Β°C for 15min #* Add RCA master mix with aa-dUTP, run RCA for 20 hr. # Fix 2nd RCA with BS(PEG)9, and deactivate BS(PEG)9 with Tris pH8.0 treatment # Image ACTB on 2nd rolonies and Cy5 channel (1st rolonies) #* Decoding probe mixture: 10uL dcProbe0-Cy3 (10uM)+ 1uL Cy5-adapter for 1st rolony (100uM) + 89uL 2x SSC #* Pre heat probe mixture at 60C for 5min #* Add probe mixture to rolony sample and cool down at RT for 10min #* Wash with PBS twice and add 2mL PBS, and imaging # Image RAB7A on 2nd rolonies and Cy5 channel (1st rolonies) #* Strip probes by adding 80% Formamide in 2x SSC (pre-heat at 60C for 5min, and add and incubate at RT for 10min, and wash with PBS) #* Decoding probe mixture: 10uL dcProbe1-Cy3 (10uM)+ 1uL Cy5-adapter for 1st rolony (100uM) + 89uL 2x SSC #* Pre heat probe mixture at 60C for 5min #* Add probe mixture to rolony sample and cool down at RT for 10min #* Wash with PBS twice and add 2mL PBS, and imaging *2nd Rolony generation at 09/10~09/11, imaging at 09/11 ===Result for 1st try=== ====result==== *1st Padlock probes for ACTB were not seen well, too sparse and too few *2nd Padlock probes for RAB7A were many, more than ACTB. *Currently we don't know why there are not many signal on 2nd rolonies, becuase of... **Ampligase reaction were not good? or low efficiency? becuase of temperature in oven? incubation time? **Not enough padlock probes? or poor hybrizing efficiency? *need to figure out *We need to check all of 2nd rolonies, so we are going to use FITC-labeled probes which is the sequence for the region of 2nd RCA probes (488nm dye labeled CTTCAGCTTCCCGATATC) *We didn't do quantitative analysis yet, and will image this sample (RAB7A) with Confocal. ====Number of Rolonies==== *Use Matlab code (D:\My Documents\..\04. Matlab\Rolony_Counting_3.m) *Use epi FL ficture (2013-09-11) *'''ACTB : 1st Rolony --> 3931, 2nd(ACTB) --> 67''' **'''ACTB/1st = 1.70%''' *'''RAB7A : 1st Rolony --> 4085, 2nd(RAB7A) --> 204''' **'''RAB7A/1st = 4.99%''' ====Figures - epi FL==== *Rolony sample made at [[Hosuk:LabNotes/2013-6-25|2013-06-23, 3uL phi29]], 20x obj =====ACTB on 2nd rolonies===== {| {{table}} | 1st Rolonies, Cy5 ([[Media:S062319_1stRolony-Cy5_GeneACTB-Cy3_P02_Fig01_FLCy5.tif|Raw]]) || | ACTB on 2nd Rolonies, Cy3 ([[Media:S062319_1stRolony-Cy5_GeneACTB-Cy3_P02_Fig02_FLCy3.tif|Raw]]) || | Mergerd |- | [[File:S062319_1stRolony-Cy5_GeneACTB-Cy3_P02_Fig01_FLCy5_red.jpg|400px]] || | [[File:S062319_1stRolony-Cy5_GeneACTB-Cy3_P02_Fig02_FLCy3_cyan.jpg|400px]] || | [[File:Composite_ACTB_P02.jpg|400px]] | |} =====RAB7A on 2nd rolonies===== {| {{table}} | 1st Rolonies, Cy5 ([[Media:S062319_1stRolony-Cy5_GeneRAB7A-Cy3_P02_Fig02_FLCy5_EM20.tif|Raw]]) || | RAB7A on 2nd Rolonies, Cy3 ([[Media:S062319_1stRolony-Cy5_GeneRAB7A-Cy3_P02_Fig01_FLCy3_EM40.tif|Raw]]) || | Mergerd |- | [[File:S062319_1stRolony-Cy5_GeneRAB7A-Cy3_P02_Fig02_FLCy5_EM20_red.jpg|400px]] || | [[File:S062319_1stRolony-Cy5_GeneRAB7A-Cy3_P02_Fig01_FLCy3_EM40_cyan.jpg|400px]] || | [[File:Composite_RAB7A_P02.jpg|400px]] | |} ====Figures - Confocal==== *Image RAB7A sample only *20x obj, oil *Red : Cy5 (1st Rolony) *Green : Cy3 (2nd, RAB7A) *2048 x 2048 resolution, FOV : 580um x 580um with zoom 1x *Z stack(10um), and maximum projection {| {{table}} | location 1, Zoom = 1x ([[Media:Experiment.lif_Series017Snapshot1_2.tif|Raw]], [[Media:Experiment.lif_Series017Snapshot1_2_cropped|Cropped]]) || | location 2, Zoom = 2x ([[Media:Experiment.lif_Series031Snapshot All1.tif|Raw]]) |- | [[File:Confocal_RAB7A_Red-1stRolony_Green-2ndRolony_pos01_zoom1x_2.png|600px]] || | [[File:Confocal_RAB7A_Red-1stRolony_Green-2ndRolony_pos02_zoom4x.png|485px]] | |} ====='''Counting RAB7A ''' (added at 2013-10-25)===== *Rolony_Counting_10.m *1st Rolony : 29641 *2nd Rolony (RAB7A) : 2811 *Overlapped RAB7A : 791 ** 791/29641 = 2.67% **[[Media:RAB7A_Overlapped_1stRolony_2013-09-12.tif|Raw]] [[File:RAB7A_Overlapped_1stRolony_2013-09-12.png|600px]]
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Template used on this page:
Template:Table
(
edit
)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information