Editing
Jie:LabNotes/CpgSeq/2009-8-5
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==shotgun library construction of Parkinson's samples== The captured DNA of samples were sent to Covaris for shearing.refer to LabNotes on [http://genome-tech.ucsd.edu/LabNotes/index.php/Jie:LabNotes/CpgSeq/2009-7-1] see 1.5.2 ===endrepair with enzymatic end-repair kit=== x10 100 ul DNA 13 ul 10X End-Repair Buffer 130 13 ul dNTP Mix 130 4 ul End-Repair Enzyme Mix 40 130 ul Total reaction volume Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O. === A tail addition=== x11 Blunt-ended DNA 10ul 10 each 10X Klenow buffer 1.6ul 17.6 1mM dATP 3ul 33 Klenow fragment (exo-) 1ul 11 37C 30min, purified with MinElute columns, eluted with 12ul EB. ===adaptor ligation=== x12 DNA 10ul 2x QuickLigase buffer (enzymatic) 15ul 180 20uM Adaptor oligo mix 3ul 36 T4 DNA QuickLigase (enzymatic) 2ul 24 Incubate at RT for 15 minutes. Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O. ===PCR=== Template 5ul 2x iProof mix 50ul Solexa_PCR_up (10uM) 4ul Solexa_PCR_lo_PE (10uM) 4ul H2O 37ul 50X SYBG I 0.2ul 98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> 72C 3min -> 15C hold. [[Image:20090807_shotgun_lib_Parkinson_samples.jpg|350px]]20090807_shotgun_lib_Parkinson_samples ===quantification of shotgun library=== [[Image:20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix.jpg|300px]]20090810_shotgun_lib_quanti_Parkinson_No1_9_Phix gel quantification results: Par_1: 6.14ng/ul x 40ul; Par_9: 7.54ng/ul x 40ul; PhiX lib: 7.43ng/ul (size 275-325bp) Nanodrop results: Par_1: 24.9ng/ul x 40ul; Par_9: 21.8ng/ul x 40ul; PhiX lib: 5.9ng/ul ===quantification with qPCR=== I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM. I dilute the Parkinson's lib with 1:10 ratio. Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG x 14 Template 1ul 2x iProof mix 25ul 350 syb_RP7 (100uM) 0.2ul Syb_FP5 (100uM) 0.2ul H2O 24ul 50X SYBG I 0.2ul 98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold. [[Image:20090812_PhiX_quantification.png|300px]] [[Media:20090812_Parkinson_sample_quantification.xls|20090812_Parkinson_sample_quantification]] {| border="1" cellpadding="5" cellspacing="0" align="center" |- | align="center" style="background:#f0f0f0;"|'''No''' | align="center" style="background:#f0f0f0;"|'''sample ''' |align="center" style="background:#f0f0f0;"|'''sample concentration''' |- |Par_1||5028||12.2nM |- |Par_2||4735||10.2nM |- |Par_3||4789||9.3nM |- |Par_4||5171||6.6nM |- |Par_5||1818||6.0nM |- |Par_6||1947||7.8nM |- |Par_7||1741||6.9nM |- |Par_8||4977||9.6nM |- |Par_9||4879||5.5nM |- |Par_10||4526||6.6nM |- |}
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information