Editing
Jie:LabNotes/CpgSeq/2009-8-7
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
==breast cancer patient peripheral blood DNA sample capture by cpg97k== ===gDNA extraction from blood=== I used the Qiagen FlexiGene DNA kit to exact the DNA from blood. yield: 05192A18: 83.5ng/ul x 100ul; 05192B09: 72.7ng/ul x 100ul ===Bisulfite conversion of patient DNA === {| border="1" cellpadding="5" cellspacing="0" align="center" |- | align="center" style="background:#f0f0f0;"|'''No''' | align="center" style="background:#f0f0f0;"|'''sample ''' |align="center" style="background:#f0f0f0;"|'''sample concentration''' | align="center" style="background:#f0f0f0;"|'''sample volumn''' | align="center" style="background:#f0f0f0;"|'''ddH2O ''' | align="center" style="background:#f0f0f0;"|'''conversion reagents''' | align="center" style="background:#f0f0f0;"|'''conversed DNA concentration and volumn''' |- | ||05192A18||83.5ng/ul x 1 tube||20ul||0ul||130ul||148.2ng/ul x 10ul |- | ||05192B09||72.7ng/ulx 1 tubes||20ul||0ul||130ul||127.8ng/ul x 10ul |- |} ===cpature by cpg97k === {| border="1" cellpadding="5" cellspacing="0" align="center" |- | align="center" style="background:#f0f0f0;"|'''No ''' | align="center" style="background:#f0f0f0;"|'''sample ''' |align="center" style="background:#f0f0f0;"|'''sample concentration''' | align="center" style="background:#f0f0f0;"|'''10xLigase buffer''' | align="center" style="background:#f0f0f0;"|'''template+cpg97k_A(60ng/ul_08/10) vol+suppress oligo+H2O''' | align="center" style="background:#f0f0f0;"|'''template+cpg97k_B(60ng/ul_08/10) vol+suppressor oligo+H2O''' |- |||05192A18 ||148.2ng/ul ||1ul||3+1.5ul+1ul+3.5ul||3+1.5ul+1ul+3.5ul |- |||05192B09 ||127.8ng/ul ||1ul||3+1.5ul+1ul+3.5ul||3+1.5ul+1ul+3.5ul |- |} PCR Template 15ul x4 2X iProof Mastermix 50ul AmpF6.3SoL (10uM) 4ul AmpR6.3SoL (10uM) 4ul 50X SYBG I 0.4ul H2O 26.6ul 98C 30S -> (98C 10S -> 58C 20S -> 72C 20S) x 8 ->(98C 10S -> 72C 20S) x 8 ->72C 3 min -> 15C hold. Qiaquick purification and e-gel size selection. ===PCR amplification with AmpF6.3NH2/AmpR6.3NH2 and dUTP:dNTP 1:40=== I did the dUTP_PCR with template from the Qiaquick purified captured targets of 97k. For each targets, I did 200ul PCR reaction. reaction system x8 H2O 42.6ul 340.8ul 2x Master mix 50ul 400ul dUTP(1mM) 2ul 16ul AmpF6.3NH2(10uM) 2ul 16ul AmpR6.3NH2(10uM) 2ul 16ul 50x SYBG I 0.4ul 3.2ul template 0.25ul/each for e-gel purified cpg97k Total 100ul 1400ul Purify with qiaquick column. Quantify with nanodrop and mix them with 1:1 ratio. ===USER and S1 digestion=== add 3ul USER to 30ul of each samples. 37C for 1h. 10 x S1 nuclease buffer: 4 ul DNA after USER digestion: 33ul S1 nuclease (10U/ul): 1ul ddH2O 2ul 37C 10mins. Minelute cloumn purify. Elute in 18ul H2O. ===endrepair with enzymatic end-repair kit=== x3 17 ul DNA 2.5 ul 10X End-Repair Buffer 7.5 2.5 ul dNTP Mix 7.5 3 ul End-Repair Enzyme Mix 9 25 ul Total reaction volume Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O. === A tail addition=== x3 Blunt-ended DNA 10ul 10 each 10X Klenow buffer 1.6ul 4.8 1mM dATP 3ul 9 Klenow fragment (exo-) 1ul 3 37C 30min, purified with MinElute columns, eluted with 12ul EB. ===adaptor ligation=== x4 DNA 10ul 2x QuickLigase buffer (enzymatic) 15ul 60 20uM Adaptor oligo mix 3ul 12 T4 DNA QuickLigase (enzymatic) 2ul 8 Incubate at RT for 15 minutes. Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O. ===PCR=== x4 Template 10ul 2x iProof mix 50ul 200 Solexa_PCR_up (10uM) 4ul 16 Solexa_PCR_lo_PE (10uM) 4ul 16 H2O 37ul 148 50X SYBG I 0.2ul 0.8 98C 30sec -> 4 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 8 cycles of (98C 10sec -> 72C 15 sec)-> 72C 3min -> 15C hold. [[Image:20090817_breast_cancer cell shotgun lib.jpg|300px]]20090817_breast cancer cell shotgun lib I did the e-gel size selection and quantification with Q-PCR ===quantification of PCR amplicons=== I dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM. I dilute the sample lib with 1:10 and 1:50 ratio. Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG x 16 Template 1ul 2x iProof mix 25ul 350 syb_RP7 (100uM) 0.2ul Syb_FP5 (100uM) 0.2ul H2O 24ul 50X SYBG I 0.2ul 98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold. [[Media:20090817_quantification of breast cancer WBC.xls|20090817_quantification of breast cancer WBC]] 05192A18: 8.63nM; 05192B09: 6.67nM;
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information