Editing
Matt:LabNotes/2013-7-1
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-6-28 ====Amplification with Sequencing Adapters==== *Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007) **[[Media:probe2padlockFISSEQ_2012_0bp.txt|./probe2padlockFISSEQ_2012_0bp.pl]] **[[Media:probe2padlockFISSEQ_2012_20bp.txt|./probe2padlockFISSEQ_2012_20bp.pl]] *Since this is the same design as LC Sciences probes that Noi used, I'll use the same [http://genome-tech.ucsd.edu/LabNotes/index.php/Illumina_GA/Oligo_info#Primers_for_LC_Sciences_library-free_protocol primers] {| {{table}} border = 1 | align="center" style="background:#f0f0f0;"|'''Tube #''' | align="center" style="background:#f0f0f0;"|'''Sample''' | align="center" style="background:#f0f0f0;"|'''Index#''' |- | 1||NTC-0gap||Indx7 |- | 2||gDNA-0gap||Indx45 |- | 3||cDNA-0gap||Indx76 |- | 4||NTC-20gap||Indx7 |- | 5||gDNA-20gap||Indx77 |- | 6||cDNA-20gap||Indx78 |- | |} <br>Will also do duplicate for each sample so 12 reactions total<br> {| {{table}} border = 1 | align="center" style="background:#f0f0f0;"|'''Components''' | align="center" style="background:#f0f0f0;"|'''1 rxn''' | align="center" style="background:#f0f0f0;"|'''13 rxn''' |- | Captured template||12.00||0.00 |- | 10uM Forward+Indx||2.00||0.00 |- | 10uM Reverse||2.00||26.00 |- | 2x KAPA SYBG fast MM||50.00||650.00 |- | H2O||34.00||442.00 |- | Total||100.00||1300.00 |} Program *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold [[File:07012013_Agi26kCapturedSequencePCRGraph.JPG | 650px]] *Sample with greatest amplification is NTC for 20gap probes **Will run a gel to see what is causing the signal *Both 20gap samples did not show amplification suggesting something went wrong **Possibly the dNTP mix used during capture reaction is to blame because Noi says the Stoffel fragment enzyme was working a week ago **Will do a PCR with the same dNTP mix to see *Both 0gap samples showed moderate amplification and NTC was as expected PCR'd an additional 3 cycles to make a total of 21 to match CustomArray Program *98°C 30sec -> (98°C 10sec -> 72°C 2min30sec) x3 cycles ====Gel Check==== [[File:2013-07-01_Agi26kCapturedPCR_GelCheck.jpg | 450px]] *Looks like I mixed up 20gap samples while pipetting but I'm not sure how **I was very careful about adding correct captured template to each PCR reaction **If this was caused by switching two samples, then expect to see two bright bands and one dim/nonexistent one **Also each sample is consistent with its duplicate in qPCR curve, and it is unlikely I would pipette incorrectly twice **Also a faint band around 300bp can still be seen in samples (possibly will be brighter after 3 more amplification cycles) *It is possible a mistake happened during capture reaction but I was also very careful with putting reagents in the right tubes during that step *Another possibility is that NTC-20gap had contamination somehow and everything else works fine **Will know more after testing dNTP mix tomorrow Continued on: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-7-2
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Template used on this page:
Template:Table
(
edit
)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information