Editing
Matt:LabNotes/2017-4-22
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
=In tube SplintR Test with formamide and ET SSB= ==Test Conditions== #Standard: SplintR only #SplintR incubated for 30min instead of 15min #SplintR + 10% formamide #SplintR + 20% formamide #SplintR + 30% formamide #SplintR + 250ng ET SSB #SplintR + 250ng ET SSB added first #Positive Control: Ampligase *For each test conditions have **one sample with ALL padlock probes and template ***Should see amplification **one sample with all padlock probes and template MINUS ppMALAT1 ***Should not see amplification ==Padlock Probes and Template== *Same as [[Matt:LabNotes/2017-4-7]] with the addition of ppMALAT1 for consistency *ppCUX2 *ppBCL11B *ppRELN_1 *ppGFAP *ppMALAT1 **/5Phos/TTTCTGCCTTTACTTATCAATTCCTTCAGCTTCCCGATATCCGACGGTCTACTTCGTCGCGTCAGACCAAATGGAGGTATGACATATAATCT *Template for ppMALAT1: MALAT1_template **/5AmMC6/GAATTGATAAGTAAAGGCAGAAA AGATTATATGTCATACCTCCAT ==Protocol== {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8</hiddentext> |- style="font-size:11pt" valign="bottom" | width="51" height="14" | Sample # | width="51" | Condition | width="195" | 100nM template + PP mix | width="140" | 55C 17hr | width="51" | 55C | width="51" | 37C | width="51" | Exo I/III |- style="font-size:11pt" valign="bottom" | align="right" height="14" | 1 | SplintR 15min | 1.5 or 1.8ul (0.3ul of each 10uM oligo) | 3ul SplintR Buffer + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |- style="font-size:11pt" valign="bottom" | align="right" height="14" | 2 | SplintR 30min | 1.5 or 1.8ul (0.3ul of each 10uM oligo) | 3ul SplintR Buffer + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |- style="font-size:11pt" valign="bottom" | align="right" height="14" | 3 | SplintR + 10% formamide | 1.5 or 1.8ul (0.3ul of each 10uM oligo) | 3ul SplintR Buffer + 3ul formamide + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |- style="font-size:11pt" valign="bottom" | align="right" height="14" | 4 | SplintR + 20% formamide | 1.5 or 1.8ul (0.3ul of each 10uM oligo) | 3ul SplintR Buffer + 6ul formamide + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |- style="font-size:11pt" valign="bottom" | align="right" height="14" | 5 | SplintR + 30% formamide | 1.5 or 1.8ul (0.3ul of each 10uM oligo) | 3ul SplintR Buffer + 9ul formamide + H2O to 30ul | - | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |- style="font-size:11pt" valign="bottom" | align="right" height="14" | 6 | SplintR + ET SSB | 1.5 or 1.8ul (0.3ul of each 10uM oligo) | 3ul SplintR Buffer + H2O to 30ul | - | Add 3ul SplintR Mix + 0.4ul ET SSB | 1ul Exo I + 1ul Exo II |- style="font-size:11pt" valign="bottom" | align="right" height="14" | 7 | SplintR + 2step ET SSB | 1.5 or 1.8ul (0.3ul of each 10uM oligo) | 3ul SplintR Buffer + H2O to 30ul | Add 0.4ul ET SSB | Add 3ul SplintR Mix | 1ul Exo I + 1ul Exo II |- style="font-size:11pt" valign="bottom" | align="right" height="14" | 8 | Ampligase | 1.5 or 1.8ul (0.3ul of each 10uM oligo) | 3ul Ampligase Buffer + H2O to 30ul | Add 3ul Ampligase Mix | - | 1ul Exo I + 1ul Exo II + 0.4ul ET SSB |} #Combine padlock probes and template in 1X Ligase buffer and possibly formamide #Add mineral oil on top #Incubate at 55C for 17hr #To sample 7 (2-step ET SSB) add 200ng (0.4ul) of ET SSB and keep at 55C for 30min #To sample 8 add 3ul Ampligase Mix and incubate at 55C for 1hr30min #*Ampligase Mix: 1ul Ampligase + 1ul 10X Ampligase Buffer + 8ul H2O #After sample 7 has ET SSB for 30min move samples 1-7 to 37C #Add 3ul SplintR Mix and incubate 15min #*SplintR Mix: 27ul SplintR + 4.5ul 10X SplintR Buffer + 13.5ul H2O #*30min incubation for sample 2 #*Also add 0.4ul ET SSB to sample 6 #Put all samples on ice and add 2ul Exo I/III mix #*Also add 0.4ul ET SSB to samples 1-5 and 8 #Incubate at 37C for 1hr #qPCR all 16 samples {| {{table}} | align="center" style="background:#f0f0f0;"|'''Components''' | align="center" style="background:#f0f0f0;"|'''1X Volume''' | align="center" style="background:#f0f0f0;"|'''16X Volume''' |- | Captured template||5||0 |- | 10uM ISB_CA_AF||0.4||6.4 |- | 10uM ISB_CA_AR.T1||0.4||6.4 |- | 2X KAPA SYBG MM||12.5||200 |- | H2O||6.7||107.2 |- | Total||25||320 |} *Aliquot 20ul from 16X master mix and add 5ul captured template Program 98C 1min -> (98C 10s -> 52C 20s -> 72C 20s)x26 -> 72C 3min ===Mistakes=== *Forgot to heat inactivate (incubate at 94C 10min) after ligation and before Exo I/III *Accidentally added 3ul 10X SplintR Buffer to samples 1-3 that HAVE ppMALAT1 **Still added 3ul SplintR Mix afterwards *Do zymo columns after Exo I/III next time ==Results== [[Media:20170423_qPCR_PPcapture_SplintRformamideETSSB.xlsx|raw data here]]<br> [[File:20170423_qPCR_ppCapture_SplintRformamideETSSB.PNG|650px]] *Possible options: 10% formamide [[File:20170423_qPCR_PPcapture_SplintRformamideETSSB_ScatterPlot.PNG|450px]] *No difference between 15min and 30min SplintR incubation times *ET SSB added does increase the number of captured padlock probes **Adding ET SSB before SplintR vs during SplintR makes no difference *Next time do a ET SSB + 10% formamide sample *Next time try less template concentration... see if it can distinguish the smaller amount
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Template used on this page:
Template:Table
(
edit
)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information