Editing
Noi/NOTES/2012-6-5
Jump to navigation
Jump to search
Warning:
You are not logged in. Your IP address will be publicly visible if you make any edits. If you
log in
or
create an account
, your edits will be attributed to your username, along with other benefits.
Anti-spam check. Do
not
fill this in!
* [[http://genome-tech.ucsd.edu/LabNotes/index.php/noi:DMR220k_LabNotes '''Link to calendar''']] = Randomly tagging primer experiment = * Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Noi/NOTES/2012-6-3 == Sanger sequencing results of the amplicons amplified with randomly tagging primers (with USER)== '''AmpF7AUSol:''' AATGATACGGCGACCACCGAGAUCUACAC'''AAAAAAA'''CACUCUCAGAUGTUAUCGAGGUCCGAC<br> '''AmpF7AUSol:''' AATGATACGGCGACCACCGAGAUCUACAC'''NNNNNNN'''CACUCUCAGAUGTUAUCGAGGUCCGAC<br> '''Syb_FP5A:''' AATGATACGGCGACCACCGAG<br> '''Syb_RP7:''' CAAGCAGAAGACGGCATACGAG<br> '''Check Sanger's sequencing result roughly before sending more clones''' * Primimg with Syb_RP-7: read reverse complementary of the AmpFA/NU.Sol strand '''qs (quality score)''' '''Sequence correct''' '''7nt=AAAAAAA''' '''Note''' '''contain AGAGTG(7A or7N)GTG''' 1U-1 29 seem to (overlapping peaks) yes, :Homopolymeric or Repetitive Region, **request for free repeat 1U-2 29 yes yes, :Homopolymeric or Repetitive Region 1U-3 33 yes yes, chromatogram very clear even the peak very low 1U-4 32 yes yes, 1U-5 42 yes yes, 1U-6 43 yes yes, 1U-7 42 yes yes, chromatogram very clear even the peak very low 1U-8 14 seem to (overlapping peaks) yes Non-specific, **request for free repeat 1U-9 31 yes yes, 1U-10 43 no no, This clone has a shift band higher than other positive clones on E-gel will look closer to the sequences (seem to be neither AmpFNU.Sol nor AmpFAU.Sol) == 1ul USER/1U == <br> [[File:1U-1.png| 450px]] [[File:1U-2.png| 450px]] [[File:1U-3.png| 450px]] [[File:1U-4.png| 450px]] [[File:1U-5.png| 450px]] [[File:1U-6.png| 450px]] [[File:1U-7.png| 450px]] [[File:1U-8.png| 450px]] [[File:1U-9.png| 450px]] [[File:1U-10.png| 450px]] * Summary: From 10 clones sequenced by Sanger sequencing ** 7 clones are clearly correct and all contain 7T ** 2 clones clearly showed 7T but show overlapping of the peaks surrounding 7T sequences --> request for free repeat ** 1 clone showed unrelated sequences of the clone amplified by AmpFNU.Sol or AmpFAU.Sol == Repeat sequencing of clone 1U-1 (1U-1_R) and 1U-8 (1U-8_R) == [[File:2012_06_04_1U-1_R.png| 450px]] [[File:2012_06_04_1U-8_R.png| 450px]] * From the chromatograms of the two clones re-sequenced, the results are pretty much the same. So in the future, I will not do re-sequencing of the samples showing '''Homopolymeric or Repetitive Region''' comment after sequencing. However, I could see that the sequences were correct since there are the poly T '''(TTTTTTT, 7T)''' and the peaks of surrounding sequences '''AGAGTG (TTTTTTT, 7T)GTG''' exist, but just the peaks that overlap. * '''Summary of 1ul USER (1U) 10 clones''' ** 9 clones showed polyT (TTTTTTT, 7T) sequences ** 1 clone showed sequences not amplified by either AmpFNU.Sol or AmpFAU.Sol ** I will mainly focus on 1ul USER validation rather than 2 or 5ul USER for the moment. * Additional Sanger sequencing validation of 18 clones of 1U (1ul USER): http://genome-tech.ucsd.edu/LabNotes/index.php/Noi/NOTES/2012-6-7 == Screen more clones for Sanger sequencing == Perform size screen of the PCR products from 2012_06_03 in 2% agarose gel, load sample 5ul each well (24 clones from each 2U or 5U) [[File:2012_06_05_size-screening-2U.png| 600px]] [[File:2012_06_05_size-screening-5U.png| 600px]] Note: Loading 5ul of PCR product is overloaded in a small well (26-well comb, 2% SYBR safe gel) - Purified 35ul PCR products with 1vol. AmPure beads and eluted with 30ul EB buffer - Measured DNA conc. by Nanodrop == DNA preparation for Sanger sequencing at GENEWIZ == {| {{table}} border = 1 style="text-align: center;" | align="center" style="background:#f0f0f0;"|'''Sample IDs''' | align="center" style="background:#f0f0f0;"|'''Conc. (ng/ul)''' | align="center" style="background:#f0f0f0;"|'''~ Volume for 50ng (ul)''' | align="center" style="background:#f0f0f0;"|'''H2O (ul)''' | align="center" style="background:#f0f0f0;"|'''10uM Syb_RP7 (ul)''' | align="center" style="background:#f0f0f0;"|'''Total volume (ul)''' |- | 2U-1||41.30||1.25||11.25||2.50||15.00 |- | 2U-2||41.30||1.25||11.25||2.50||15.00 |- | 2U-3||28.10||2.00||10.50||2.50||15.00 |- | 2U-4||39.50||1.25||11.25||2.50||15.00 |- | 2U-5||47.40||1.25||11.25||2.50||15.00 |- | 2U-6||26.30||2.00||10.50||2.50||15.00 |- | 2U-7||19.10||2.50||10.00||2.50||15.00 |- | 2U-8||16.20||3.00||9.50||2.50||15.00 |- | 2U-9||39.90||1.25||11.25||2.50||15.00 |- | 2U-10||42.20||1.25||11.25||2.50||15.00 |- | 2U-11||35.70||1.50||11.00||2.50||15.00 |- | 2U-12||32.20||1.50||11.00||2.50||15.00 |- | 2U-13||36.20||1.50||11.00||2.50||15.00 |- | 2U-14||45.80||1.25||11.25||2.50||15.00 |- | 2U-15||33.50||1.50||11.00||2.50||15.00 |- | 2U-16||35.20||1.50||11.00||2.50||15.00 |- | 5U-1||33.50||1.50||11.00||2.50||15.00 |- | 5U-2||26.00||2.00||10.50||2.50||15.00 |- | 5U-3||22.70||2.00||10.50||2.50||15.00 |- | 5U-4||26.10||2.00||10.50||2.50||15.00 |- | 5U-5||42.00||1.25||11.25||2.50||15.00 |- | 5U-6||41.00||1.25||11.25||2.50||15.00 |- | 5U-7||34.90||1.25||11.25||2.50||15.00 |- | 5U-8||38.10||1.50||11.00||2.50||15.00 |- | 5U-9||46.30||1.25||11.25||2.50||15.00 |- | 5U-10||41.80||1.25||11.25||2.50||15.00 |- | 5U-11||41.20||1.25||11.25||2.50||15.00 |- | 5U-12||30.20||1.50||11.00||2.50||15.00 |- | 5U-13||27.50||2.00||10.50||2.50||15.00 |- | 5U-14||35.70||1.50||11.00||2.50||15.00 |- | 5U-15||38.00||1.25||11.25||2.50||15.00 |- | 5U-16||33.30||1.50||11.00||2.50||15.00 |} * Aliquot 48ul, add 2ul of cell lysis DNA template '''Tracking number: 10-196512843 ( Tagging_validation_2012_06_05):''' under Dinh's account '''PO#: 90443171:''' generated by Rui (Total 60, 2012_06_04 send 10 samples, 2012_06_05 send 32 samples => 18 reactions left) == PCR == {| {{table}} border = 1 | align="center" style="background:#f0f0f0;"|'''Components''' | align="center" style="background:#f0f0f0;"|'''1 rxn''' | align="center" style="background:#f0f0f0;"|'''58 rxn mix''' |- | Cell lysis||2.00||0.00 |- | 10uM Syb_FP5A||1.00||58.00 |- | 10uM Syb_RP7||1.00||58.00 |- | 2X Taq MM||25.00||1,450.00 |- | H20||21.00||1,218.00 |- | Total||50.00||2,784.00 |} '''Program''' 96C 3min -> (95C 30s -> 58C 45s -> 72C 45s)x36 cycles --> 72C 5min --> hold at 15C * Continued on: http://genome-tech.ucsd.edu/LabNotes/index.php/Noi/NOTES/2012-6-6
Summary:
Please note that all contributions to ZhangLabWiki may be edited, altered, or removed by other contributors. If you do not want your writing to be edited mercilessly, then do not submit it here.
You are also promising us that you wrote this yourself, or copied it from a public domain or similar free resource (see
ZhangLabWiki:Copyrights
for details).
Do not submit copyrighted work without permission!
Cancel
Editing help
(opens in new window)
Template used on this page:
Template:Table
(
edit
)
Navigation menu
Personal tools
Not logged in
Talk
Contributions
Create account
Log in
Namespaces
Page
Discussion
English
Views
Read
Edit
View history
More
Search
Navigation
Main Page
Current events
Recent changes
Random page
Investigators
Matt Cai
Song Chen
Eric Chu
Dinh Diep
Elizabeth Duong
Shicheng Guo
Alan Fung
Daniel Jacobsen
Blue Lake
Huy Lam
Alice Li
Andrew Richards
Brandon Sos
Chris Wei
Yan Wu
Kun Zhang
Tools
What links here
Related changes
Special pages
Page information