Jie:LabNotes/oligo sequences: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

25 November 2008

29 October 2008

20 October 2008

19 October 2008

29 September 2008

19 September 2008

4 September 2008

26 August 2008

  • curprev 00:5100:51, 26 August 2008>Jie deng 76 bytes +76 New page: CirclehelperV4_short(20080825): AACAGTGCTCTTCCAGTCTACTAGCCTCATGCGTATCCGATC