Jie:LabNotes/CpgSeq/2009-8-7: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Jie deng
No edit summary
>Sam Chiang
No edit summary
 
(15 intermediate revisions by 2 users not shown)
Line 21: Line 21:
|-
|-
|}
|}


===cpature by cpg97k ===  
===cpature by cpg97k ===  
Line 29: Line 30:
|align="center" style="background:#f0f0f0;"|'''sample concentration'''
|align="center" style="background:#f0f0f0;"|'''sample concentration'''
| align="center" style="background:#f0f0f0;"|'''10xLigase buffer'''
| align="center" style="background:#f0f0f0;"|'''10xLigase buffer'''
| align="center" style="background:#f0f0f0;"|'''template+cpg97k_A(25.6ng/ul_06/18) vol+suppress oligo+H2O'''
| align="center" style="background:#f0f0f0;"|'''template+cpg97k_A(60ng/ul_08/10) vol+suppress oligo+H2O'''
| align="center" style="background:#f0f0f0;"|'''template+cpg97k_B(21ng/ul_06/18) vol+suppressor oligo+H2O'''
| align="center" style="background:#f0f0f0;"|'''template+cpg97k_B(60ng/ul_08/10) vol+suppressor oligo+H2O'''
|-
|-
|||05192A18 ||148.2ng/ul ||1ul||4+2.5ul+1ul+1.5ul||4+2ul+1ul+2ul
|||05192A18 ||148.2ng/ul ||1ul||3+1.5ul+1ul+3.5ul||3+1.5ul+1ul+3.5ul
|-
|-
|||05192B09 ||127.8ng/ul ||1ul||4+2.5ul+1ul+1.5ul||4+2ul+1ul+2ul
|||05192B09 ||127.8ng/ul ||1ul||3+1.5ul+1ul+3.5ul||3+1.5ul+1ul+3.5ul
|-
|-
}
|}
 
PCR
 
Template                15ul        x4
2X iProof Mastermix    50ul   
AmpF6.3SoL (10uM)        4ul     
AmpR6.3SoL (10uM)        4ul         
50X SYBG I            0.4ul     
H2O                  26.6ul   
 
98C 30S -> (98C 10S -> 58C 20S -> 72C 20S) x 8 ->(98C 10S -> 72C 20S) x 8 ->72C 3 min -> 15C hold.
Qiaquick purification and e-gel size selection.
 
===PCR amplification with AmpF6.3NH2/AmpR6.3NH2 and dUTP:dNTP 1:40===
 
I did the dUTP_PCR with template from the Qiaquick purified captured targets of 97k. For each targets, I did 200ul PCR reaction.
reaction system                                                x8   
H2O                                                42.6ul    340.8ul   
2x Master mix                                        50ul      400ul     
dUTP(1mM)                                            2ul      16ul     
AmpF6.3NH2(10uM)                                      2ul      16ul     
AmpR6.3NH2(10uM)                                      2ul      16ul   
50x SYBG I                                          0.4ul      3.2ul   
template                                          0.25ul/each for e-gel purified cpg97k
Total                                              100ul      1400ul
 
Purify with qiaquick column. Quantify with nanodrop and mix them with 1:1 ratio.
 
===USER and S1 digestion===
 
add 3ul USER to 30ul of each samples. 37C for 1h.
                                         
10 x S1 nuclease buffer:  4 ul         
DNA after USER digestion: 33ul           
S1 nuclease (10U/ul):      1ul           
ddH2O                      2ul         
 
37C 10mins.
Minelute cloumn purify. Elute in 18ul H2O.
 
===endrepair with enzymatic end-repair kit===
 
                                        x3
17 ul DNA
2.5 ul 10X End-Repair Buffer          7.5
2.5 ul dNTP Mix                        7.5
  3  ul End-Repair Enzyme Mix            9
25  ul Total reaction volume
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.
 
=== A tail addition===
 
                                  x3
  Blunt-ended DNA        10ul      10 each
  10X Klenow buffer      1.6ul    4.8
  1mM dATP                3ul      9
  Klenow fragment (exo-)  1ul      3
  37C 30min, purified with MinElute columns, eluted with 12ul EB.
 
===adaptor ligation===
 
                                              x4
    DNA                                10ul
    2x QuickLigase buffer (enzymatic)  15ul    60
    20uM Adaptor oligo mix              3ul    12
    T4 DNA QuickLigase (enzymatic)      2ul    8
    Incubate at RT for 15 minutes.
    Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.
 
===PCR===
                                  x4
  Template                10ul       
  2x iProof mix          50ul  200     
  Solexa_PCR_up (10uM)    4ul    16   
  Solexa_PCR_lo_PE (10uM) 4ul    16   
  H2O                    37ul  148   
  50X SYBG I            0.2ul  0.8
98C 30sec -> 4 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 8 cycles of (98C 10sec -> 72C 15 sec)->
72C 3min -> 15C hold.
 
[[Image:20090817_breast_cancer cell shotgun lib.jpg|300px]]20090817_breast cancer cell shotgun lib
 
I did the e-gel size selection and quantification with Q-PCR
 
===quantification of PCR amplicons===
I dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM.
I dilute the sample lib with 1:10 and 1:50 ratio.
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
                                    x 16
  Template                1ul         
  2x iProof mix          25ul        350
  syb_RP7 (100uM)        0.2ul       
  Syb_FP5 (100uM)        0.2ul       
  H2O                    24ul     
  50X SYBG I            0.2ul
 
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
 
[[Media:20090817_quantification of breast cancer WBC.xls|20090817_quantification of breast cancer WBC]]
 
05192A18: 8.63nM;
05192B09: 6.67nM;

Latest revision as of 01:20, 18 August 2009

breast cancer patient peripheral blood DNA sample capture by cpg97k[edit]

gDNA extraction from blood[edit]

I used the Qiagen FlexiGene DNA kit to exact the DNA from blood. yield:
05192A18: 83.5ng/ul x 100ul;
05192B09: 72.7ng/ul x 100ul

Bisulfite conversion of patient DNA[edit]

No sample sample concentration sample volumn ddH2O conversion reagents conversed DNA concentration and volumn
05192A18 83.5ng/ul x 1 tube 20ul 0ul 130ul 148.2ng/ul x 10ul
05192B09 72.7ng/ulx 1 tubes 20ul 0ul 130ul 127.8ng/ul x 10ul


cpature by cpg97k[edit]

No sample sample concentration 10xLigase buffer template+cpg97k_A(60ng/ul_08/10) vol+suppress oligo+H2O template+cpg97k_B(60ng/ul_08/10) vol+suppressor oligo+H2O
05192A18 148.2ng/ul 1ul 3+1.5ul+1ul+3.5ul 3+1.5ul+1ul+3.5ul
05192B09 127.8ng/ul 1ul 3+1.5ul+1ul+3.5ul 3+1.5ul+1ul+3.5ul
PCR
Template                15ul        x4
2X iProof Mastermix     50ul     
AmpF6.3SoL (10uM)        4ul       
AmpR6.3SoL (10uM)        4ul          
50X SYBG I             0.4ul      
H2O                   26.6ul    
98C 30S -> (98C 10S -> 58C 20S -> 72C 20S) x 8 ->(98C 10S -> 72C 20S) x 8 ->72C 3 min -> 15C hold. 
Qiaquick purification and e-gel size selection. 

PCR amplification with AmpF6.3NH2/AmpR6.3NH2 and dUTP:dNTP 1:40[edit]

I did the dUTP_PCR with template from the Qiaquick purified captured targets of 97k. For each targets, I did 200ul PCR reaction.
reaction system                                                 x8     
H2O                                                42.6ul     340.8ul    
2x Master mix                                        50ul      400ul      
dUTP(1mM)                                             2ul       16ul       
AmpF6.3NH2(10uM)                                      2ul       16ul       
AmpR6.3NH2(10uM)                                      2ul       16ul     
50x SYBG I                                          0.4ul      3.2ul    
template                                          0.25ul/each for e-gel purified cpg97k
Total                                               100ul      1400ul
Purify with qiaquick column. Quantify with nanodrop and mix them with 1:1 ratio.

USER and S1 digestion[edit]

add 3ul USER to 30ul of each samples. 37C for 1h.
                                         
10 x S1 nuclease buffer:  4 ul           
DNA after USER digestion: 33ul            
S1 nuclease (10U/ul):      1ul            
ddH2O                      2ul           
37C 10mins.
Minelute cloumn purify. Elute in 18ul H2O.

endrepair with enzymatic end-repair kit[edit]

                                       x3
17 ul DNA 
2.5 ul 10X End-Repair Buffer           7.5
2.5 ul dNTP Mix                        7.5
 3  ul End-Repair Enzyme Mix            9
25  ul Total reaction volume

Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.

A tail addition[edit]

                                  x3
 Blunt-ended DNA        10ul      10 each
 10X Klenow buffer      1.6ul     4.8
 1mM dATP                3ul      9
 Klenow fragment (exo-)  1ul      3
 37C 30min, purified with MinElute columns, eluted with 12ul EB. 

adaptor ligation[edit]

                                              x4
   DNA                                10ul
   2x QuickLigase buffer (enzymatic)  15ul     60
   20uM Adaptor oligo mix              3ul     12
   T4 DNA QuickLigase (enzymatic)      2ul     8
   Incubate at RT for 15 minutes.
   Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.

PCR[edit]

                                 x4
  Template                10ul        
  2x iProof mix          50ul   200       
  Solexa_PCR_up (10uM)    4ul    16    
  Solexa_PCR_lo_PE (10uM) 4ul    16    
  H2O                     37ul  148     
  50X SYBG I             0.2ul  0.8

98C 30sec -> 4 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 8 cycles of (98C 10sec -> 72C 15 sec)-> 72C 3min -> 15C hold.

File:20090817 breast cancer cell shotgun lib.jpg20090817_breast cancer cell shotgun lib

I did the e-gel size selection and quantification with Q-PCR

quantification of PCR amplicons[edit]

I dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM.
I dilute the sample lib with 1:10 and 1:50 ratio. 
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
                                   x 16
 Template                 1ul          
 2x iProof mix           25ul        350
 syb_RP7 (100uM)        0.2ul        
 Syb_FP5 (100uM)        0.2ul        
 H2O                     24ul       
 50X SYBG I             0.2ul
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.

20090817_quantification of breast cancer WBC

05192A18: 8.63nM;
05192B09: 6.67nM;