AlanFung:LabNotes/DNA/2009-8-18: Difference between revisions
Jump to navigation
Jump to search
>Alan6017518 |
>Alan6017518 |
||
Line 30: | Line 30: | ||
*Dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM | *Dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM | ||
*Dilute the samples to 1:10 and 1:50 ratio | *Dilute the samples to 1:10 and 1:50 ratio | ||
*1:10-Add 1ul of sample to 9ul H20 | |||
*1:50-Add 1ul of 1:10 sample to 4ul H20 | |||
Syb_FP5: ATGATACGGCGACCACCGAG | Syb_FP5: ATGATACGGCGACCACCGAG | ||
Syb_RP7: CAAGCAGAAGACGGCATACGAG | Syb_RP7: CAAGCAGAAGACGGCATACGAG |
Revision as of 22:49, 18 August 2009
Digestion with MmeI
PGP4 | PGP6 | PGP10 | A | B | |
Sample | 20 | 20 | 20 | 10 | 10 |
10X NEBuffer 4 | 4 | 4 | 4 | 3 | 3 |
1mM SAM (fresh) | 8 | 8 | 8 | 6 | 6 |
2U/ul MmeI | 1 | 1 | 1 | 1 | 1 |
ddH20 | 7 | 7 | 7 | 10 | 10 |
Total | 40 | 40 | 40 | 30 | 30 |
1mM SAM: 32mM SAM 1ul + 31ul ddH2O. 37C 2h.
- Qiaquick column purification. Elute in 12ul EB.
quantification with qPCR
- Dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM
- Dilute the samples to 1:10 and 1:50 ratio
- 1:10-Add 1ul of sample to 9ul H20
- 1:50-Add 1ul of 1:10 sample to 4ul H20
Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG
1nM PhiX | 1:10 PGP4 | 1:10 PGP10 | 1:10 50192B |
1nM PhiX | 1:10 PGP4 | 1:10 PGP10 | 1:10 50192B |
0.1nM PhiX | 1:50 PGP4 | 1:50 PGP10 | 1:50 50192B |
0.1nM PhiX | 1:50 PGP4 | 1:50 PGP10 | 1:50 50192B |
0.025nM PhiX | 1:10 PGP6 | 1:10 50192A | |
0.025nM PhiX | 1:10 PGP6 | 1:10 50192A | |
0.005nM PhiX | 1:50 PGP6 | 1:50 50192A | |
0.005nM PhiX | 1:50 PGP6 | 1:50 50192A | |
X29 | |||
Template | 1ul | ||
2X iProof Mix | 25 | 725 | |
SYB_RP7 (100uM) | 0.2 | 5.8 | |
SYB_FP5 (100uM) | 0.2 | 5.8 | |
H2O | 24 | ||
50X SYBR I | 0.2 | 5.8 | |
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.