AlanFung:LabNotes/DNA/2009-8-18: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Alan6017518
>Alan6017518
 
(4 intermediate revisions by the same user not shown)
Line 5: Line 5:
| align="center" style="background:#f0f0f0;"|'''PGP6'''
| align="center" style="background:#f0f0f0;"|'''PGP6'''
| align="center" style="background:#f0f0f0;"|'''PGP10'''
| align="center" style="background:#f0f0f0;"|'''PGP10'''
| align="center" style="background:#f0f0f0;"|'''A'''
| align="center" style="background:#f0f0f0;"|'''5012A'''
| align="center" style="background:#f0f0f0;"|'''B'''
| align="center" style="background:#f0f0f0;"|'''5012B'''
|-
|-
| Sample||20||20||20||10||10
| Sample||20||20||20||10||10
Line 25: Line 25:
   1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
   1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
   37C 2h.  
   37C 2h.  
*Qiaquick column purification. Elute in 12ul EB.
*Qiaquick column purification. Elute in 30ul EB.


===quantification with qPCR===
===quantification with qPCR===
*Dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM
*Dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM
*Dilute the samples to 1:10 and 1:50 ratio
*Dilute the samples to 1:10 and 1:50 ratio
*1:10-Add 1ul of sample to 9ul H20
*1:50-Add 1ul of 1:10 sample to 4ul H20
  Syb_FP5: ATGATACGGCGACCACCGAG
  Syb_FP5: ATGATACGGCGACCACCGAG
  Syb_RP7: CAAGCAGAAGACGGCATACGAG
  Syb_RP7: CAAGCAGAAGACGGCATACGAG
Line 59: Line 61:
| SYB_FP5 (100uM)||0.2||5.8||
| SYB_FP5 (100uM)||0.2||5.8||
|-
|-
| H2O||24||||
| H2O||24||696||
|-
|-
| 50X SYBR I||0.2||5.8||
| 50X SYBR I||0.2||5.8||
|-
| Toal||||1438.4||
|
|}
98C 30sec -> 30 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
*stopped when curve reached plateau
{| {{table}}
| align="center" style="background:#f0f0f0;"|''''''
| align="center" style="background:#f0f0f0;"|'''nM'''
| align="center" style="background:#f0f0f0;"|'''sample ul'''
| align="center" style="background:#f0f0f0;"|'''Tris-CL ul'''
| align="center" style="background:#f0f0f0;"|'''HP3'''
| align="center" style="background:#f0f0f0;"|'''total'''
|-
| PGP4||1.71||10||6.25||0.86||17.1
|-
| PGP6||1.21||10||1.5||0.61||12.1
|-
| PGP10||1.56||10||4.82||0.78||15.6
|-
| 50192A||2.44||10||13.18||1.22||24.4
|-
| 50192B||1.4||10||3.3||0.7||14
|-
| ||||||||||
|-
| PGP6||1.21||20||2.99||1.21||24.2
|-
|-
|  
|  
|}
|}
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.

Latest revision as of 16:33, 20 August 2009

Digestion with MmeI[edit]

PGP4 PGP6 PGP10 5012A 5012B
Sample 20 20 20 10 10
10X NEBuffer 4 4 4 4 3 3
1mM SAM (fresh) 8 8 8 6 6
2U/ul MmeI 1 1 1 1 1
ddH20 7 7 7 10 10
Total 40 40 40 30 30
 1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
 37C 2h. 
  • Qiaquick column purification. Elute in 30ul EB.

quantification with qPCR[edit]

  • Dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM
  • Dilute the samples to 1:10 and 1:50 ratio
  • 1:10-Add 1ul of sample to 9ul H20
  • 1:50-Add 1ul of 1:10 sample to 4ul H20
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
1nM PhiX 1:10 PGP4 1:10 PGP10 1:10 50192B
1nM PhiX 1:10 PGP4 1:10 PGP10 1:10 50192B
0.1nM PhiX 1:50 PGP4 1:50 PGP10 1:50 50192B
0.1nM PhiX 1:50 PGP4 1:50 PGP10 1:50 50192B
0.025nM PhiX 1:10 PGP6 1:10 50192A
0.025nM PhiX 1:10 PGP6 1:10 50192A
0.005nM PhiX 1:50 PGP6 1:50 50192A
0.005nM PhiX 1:50 PGP6 1:50 50192A
X29
Template 1ul
2X iProof Mix 25 725
SYB_RP7 (100uM) 0.2 5.8
SYB_FP5 (100uM) 0.2 5.8
H2O 24 696
50X SYBR I 0.2 5.8
Toal 1438.4

98C 30sec -> 30 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.

  • stopped when curve reached plateau
' nM sample ul Tris-CL ul HP3 total
PGP4 1.71 10 6.25 0.86 17.1
PGP6 1.21 10 1.5 0.61 12.1
PGP10 1.56 10 4.82 0.78 15.6
50192A 2.44 10 13.18 1.22 24.4
50192B 1.4 10 3.3 0.7 14
PGP6 1.21 20 2.99 1.21 24.2