AlanFung:LabNotes/DNA/2009-8-18: Difference between revisions
Jump to navigation
Jump to search
>Alan6017518 |
>Alan6017518 |
||
(One intermediate revision by the same user not shown) | |||
Line 5: | Line 5: | ||
| align="center" style="background:#f0f0f0;"|'''PGP6''' | | align="center" style="background:#f0f0f0;"|'''PGP6''' | ||
| align="center" style="background:#f0f0f0;"|'''PGP10''' | | align="center" style="background:#f0f0f0;"|'''PGP10''' | ||
| align="center" style="background:#f0f0f0;"|''' | | align="center" style="background:#f0f0f0;"|'''5012A''' | ||
| align="center" style="background:#f0f0f0;"|''' | | align="center" style="background:#f0f0f0;"|'''5012B''' | ||
|- | |- | ||
| Sample||20||20||20||10||10 | | Sample||20||20||20||10||10 | ||
Line 61: | Line 61: | ||
| SYB_FP5 (100uM)||0.2||5.8|| | | SYB_FP5 (100uM)||0.2||5.8|| | ||
|- | |- | ||
| H2O||24|||| | | H2O||24||696|| | ||
|- | |- | ||
| 50X SYBR I||0.2||5.8|| | | 50X SYBR I||0.2||5.8|| | ||
|- | |- | ||
| Toal||||1438.4|| | |||
| | | | ||
|} | |} |
Latest revision as of 16:33, 20 August 2009
Digestion with MmeI[edit]
PGP4 | PGP6 | PGP10 | 5012A | 5012B | |
Sample | 20 | 20 | 20 | 10 | 10 |
10X NEBuffer 4 | 4 | 4 | 4 | 3 | 3 |
1mM SAM (fresh) | 8 | 8 | 8 | 6 | 6 |
2U/ul MmeI | 1 | 1 | 1 | 1 | 1 |
ddH20 | 7 | 7 | 7 | 10 | 10 |
Total | 40 | 40 | 40 | 30 | 30 |
1mM SAM: 32mM SAM 1ul + 31ul ddH2O. 37C 2h.
- Qiaquick column purification. Elute in 30ul EB.
quantification with qPCR[edit]
- Dilute the PhiX lib(10nM) to 1nM, 0.1nM, 0.025nM, 0.005nM
- Dilute the samples to 1:10 and 1:50 ratio
- 1:10-Add 1ul of sample to 9ul H20
- 1:50-Add 1ul of 1:10 sample to 4ul H20
Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG
1nM PhiX | 1:10 PGP4 | 1:10 PGP10 | 1:10 50192B | |
1nM PhiX | 1:10 PGP4 | 1:10 PGP10 | 1:10 50192B | |
0.1nM PhiX | 1:50 PGP4 | 1:50 PGP10 | 1:50 50192B | |
0.1nM PhiX | 1:50 PGP4 | 1:50 PGP10 | 1:50 50192B | |
0.025nM PhiX | 1:10 PGP6 | 1:10 50192A | ||
0.025nM PhiX | 1:10 PGP6 | 1:10 50192A | ||
0.005nM PhiX | 1:50 PGP6 | 1:50 50192A | ||
0.005nM PhiX | 1:50 PGP6 | 1:50 50192A | ||
X29 | ||||
Template | 1ul | |||
2X iProof Mix | 25 | 725 | ||
SYB_RP7 (100uM) | 0.2 | 5.8 | ||
SYB_FP5 (100uM) | 0.2 | 5.8 | ||
H2O | 24 | 696 | ||
50X SYBR I | 0.2 | 5.8 | ||
Toal | 1438.4 |
98C 30sec -> 30 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
- stopped when curve reached plateau
' | nM | sample ul | Tris-CL ul | HP3 | total |
PGP4 | 1.71 | 10 | 6.25 | 0.86 | 17.1 |
PGP6 | 1.21 | 10 | 1.5 | 0.61 | 12.1 |
PGP10 | 1.56 | 10 | 4.82 | 0.78 | 15.6 |
50192A | 2.44 | 10 | 13.18 | 1.22 | 24.4 |
50192B | 1.4 | 10 | 3.3 | 0.7 | 14 |
PGP6 | 1.21 | 20 | 2.99 | 1.21 | 24.2 |