Jie:LabNotes/CpgSeq/2009-9-8: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Jie deng
(New page: ==shotgun library construction of PGP samples captured by cpg97k== The captured DNA of samples were sent to Billy for shearing.refer to LabNotes on [http://genome-tech.ucsd.edu/LabNotes/i...)
 
>Jie deng
No edit summary
Line 13: Line 13:
  1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
  1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
  37C 2h
  37C 2h
  MinElute column purify. Elute in 11ul EB.
  MinElute column purify. Elute in 20ul EB. E-gel size selection(100bp).




===endrepair with enzymatic end-repair kit===
===endrepair with enzymatic end-repair kit===
                                         x10
                                         x7
100 ul DNA  
  20 ul DNA  
  13 ul 10X End-Repair Buffer          130
  3 ul 10X End-Repair Buffer          21
  13 ul dNTP Mix                        130
  3 ul dNTP Mix                        21
   4 ul End-Repair Enzyme Mix           40
   4 ul End-Repair Enzyme Mix           28
130 ul Total reaction volume
  30 ul Total reaction volume
  Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.
  Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.



Revision as of 17:11, 8 September 2009

shotgun library construction of PGP samples captured by cpg97k

The captured DNA of samples were sent to Billy for shearing.refer to LabNotes on [1] 

digest with MmeI

                                                  x7 
Total                               160ul      
DNA                                 100ul            
10X NEBuffer 4                       16ul         112
1mM SAM(fresh)                       32ul         224
2U/ul Mme I                           8ul          56 
ddH2O                                4ul           28

1mM SAM: 32mM SAM 1ul + 31ul ddH2O.
37C 2h
MinElute column purify. Elute in 20ul EB. E-gel size selection(100bp).


endrepair with enzymatic end-repair kit

                                       x7
 20 ul DNA 
  3 ul 10X End-Repair Buffer           21
  3 ul dNTP Mix                        21
  4 ul End-Repair Enzyme Mix           28
  30 ul Total reaction volume
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O.

A tail addition

                                   x11
  Blunt-ended DNA        10ul      10 each
  10X Klenow buffer      1.6ul     17.6
  1mM dATP                3ul      33
  Klenow fragment (exo-)  1ul      11
  37C 30min, purified with MinElute columns, eluted with 12ul EB. 

adaptor ligation

                                               x12
    DNA                                10ul
    2x QuickLigase buffer (enzymatic)  15ul     180
    20uM Adaptor oligo mix              3ul      36
    T4 DNA QuickLigase (enzymatic)      2ul      24
    Incubate at RT for 15 minutes.
    Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.

PCR

   Template                5ul        
   2x iProof mix          50ul       
   Solexa_PCR_up (10uM)    4ul        
   Solexa_PCR_lo_PE (10uM) 4ul        
   H2O                     37ul       
   50X SYBG I             0.2ul
98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> 
72C 3min -> 15C hold.


quantification of shotgun library with qPCR

I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM.
I dilute the Parkinson's lib with 1:10 ratio. 
Syb_FP5: ATGATACGGCGACCACCGAG
Syb_RP7: CAAGCAGAAGACGGCATACGAG
                                    x 14
  Template                 1ul          
  2x iProof mix           25ul        350
  syb_RP7 (100uM)        0.2ul        
  Syb_FP5 (100uM)        0.2ul        
  H2O                     24ul       
  50X SYBG I             0.2ul

98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.

No sample sample concentration
Par_1 5028 12.2nM
Par_2 4735 10.2nM
Par_3 4789 9.3nM
Par_4 5171 6.6nM
Par_5 1818 6.0nM
Par_6 1947 7.8nM
Par_7 1741 6.9nM
Par_8 4977 9.6nM
Par_9 4879 5.5nM
Par_10 4526 6.6nM