Jie:LabNotes/CpgSeq/2009-9-8: Difference between revisions
Jump to navigation
Jump to search
>Jie deng No edit summary |
>Jie deng No edit summary |
||
Line 16: | Line 16: | ||
===endrepair with enzymatic end-repair kit=== | ===endrepair with enzymatic end-repair kit=== | ||
PGP samples x7 | |||
20 ul DNA | 20 ul DNA | ||
3 ul 10X End-Repair Buffer 21 | 3 ul 10X End-Repair Buffer 21 | ||
Line 22: | Line 22: | ||
4 ul End-Repair Enzyme Mix 28 | 4 ul End-Repair Enzyme Mix 28 | ||
30 ul Total reaction volume | 30 ul Total reaction volume | ||
DF-iPS x2 | |||
100 ul DNA | |||
13 ul 10X End-Repair Buffer 26 | |||
13 ul dNTP Mix 26 | |||
4 ul End-Repair Enzyme Mix 8 | |||
130 ul Total reaction volume | |||
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O. | Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O. | ||
E-gel size selection(100bp). | E-gel size selection(100bp). | ||
=== A tail addition=== | === A tail addition=== |
Revision as of 20:33, 8 September 2009
shotgun library construction of PGP samples captured by cpg97k
The captured DNA of samples were sent to Billy for shearing.refer to LabNotes on [1]
digest with MmeI
x7 Total 160ul DNA 100ul 10X NEBuffer 4 16ul 112 1mM SAM(fresh) 32ul 224 2U/ul Mme I 8ul 56 ddH2O 4ul 28 1mM SAM: 32mM SAM 1ul + 31ul ddH2O. 37C 2h MinElute column purify. Elute in 20ul EB.
endrepair with enzymatic end-repair kit
PGP samples x7 20 ul DNA 3 ul 10X End-Repair Buffer 21 3 ul dNTP Mix 21 4 ul End-Repair Enzyme Mix 28 30 ul Total reaction volume
DF-iPS x2 100 ul DNA 13 ul 10X End-Repair Buffer 26 13 ul dNTP Mix 26 4 ul End-Repair Enzyme Mix 8 130 ul Total reaction volume
Incubate at room temperature for 30 minutes. Purify with minelute column. Elute in 20ul ddH2O. E-gel size selection(100bp).
A tail addition
x11 Blunt-ended DNA 10ul 10 each 10X Klenow buffer 1.6ul 17.6 1mM dATP 3ul 33 Klenow fragment (exo-) 1ul 11 37C 30min, purified with MinElute columns, eluted with 12ul EB.
adaptor ligation
x12 DNA 10ul 2x QuickLigase buffer (enzymatic) 15ul 180 20uM Adaptor oligo mix 3ul 36 T4 DNA QuickLigase (enzymatic) 2ul 24 Incubate at RT for 15 minutes. Purified with Qiaquick columns, eluted with 12ul EB. Do the TBU gel size selection of 200~225bp fragments. ethanol precipitation and elute in 10ul ddH2O.
PCR
Template 5ul 2x iProof mix 50ul Solexa_PCR_up (10uM) 4ul Solexa_PCR_lo_PE (10uM) 4ul H2O 37ul 50X SYBG I 0.2ul 98C 30sec -> 5 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) -> 7 cycles of (98C 10sec -> 72C 15 sec)-> 72C 3min -> 15C hold.
quantification of shotgun library with qPCR
I dilute the PhiX lib(10nM) to 1nM, 0.5nM, 0.25nM, 0.05nM. I dilute the Parkinson's lib with 1:10 ratio. Syb_FP5: ATGATACGGCGACCACCGAG Syb_RP7: CAAGCAGAAGACGGCATACGAG x 14 Template 1ul 2x iProof mix 25ul 350 syb_RP7 (100uM) 0.2ul Syb_FP5 (100uM) 0.2ul H2O 24ul 50X SYBG I 0.2ul
98C 30sec -> 10 cycles of (98C 10sec -> 65C 20sec -> 72C 15 sec) ->72C 3min -> 15C hold.
No | sample | sample concentration |
Par_1 | 5028 | 12.2nM |
Par_2 | 4735 | 10.2nM |
Par_3 | 4789 | 9.3nM |
Par_4 | 5171 | 6.6nM |
Par_5 | 1818 | 6.0nM |
Par_6 | 1947 | 7.8nM |
Par_7 | 1741 | 6.9nM |
Par_8 | 4977 | 9.6nM |
Par_9 | 4879 | 5.5nM |
Par_10 | 4526 | 6.6nM |