AlanFung:Protocol/Construction of Solexa sequencing Library: Difference between revisions
Jump to navigation
Jump to search
>Alan6017518 No edit summary |
>Alan6017518 |
||
(17 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
Construction of Solexa sequencing library from padlock captured PCR products using NEBNext DNA Sample Prep Master Mix Set 1 Kit (E6040S/L) | Construction of Solexa sequencing library from padlock captured PCR products using NEBNext DNA Sample Prep Master Mix Set 1 Kit (E6040S/L) | ||
*[http://www.neb.com/nebecomm/products/productE6040.asp Info] Read the FAQ!!! | *[http://www.neb.com/nebecomm/products/productE6040.asp Info] Read the FAQ!!! | ||
*[[Media:DNASPMMS1.pdf]] | *[[Media:DNASPMMS1.pdf|Protocol]] | ||
*The NEBNext DNA SPMMS 1 (I) is compatible with protocols requiring a 3´ A overhang on the library molecules to facilitate ligation to adapters containing a 5´ T overhang, such as Illumina’s Genomic DNA Sample Prep protocol for the Genome Analyzer II. | *The NEBNext DNA SPMMS 1 (I) is compatible with protocols requiring a 3´ A overhang on the library molecules to facilitate ligation to adapters containing a 5´ T overhang, such as Illumina’s Genomic DNA Sample Prep protocol for the Genome Analyzer II. | ||
*For 60bp run, we can use the library size of >180bp | |||
*For 80bp runs, the lower limit for the sequencing libraries should be 200bp. | |||
*If the library size is too small, some of the 80bp reads will reach to the other end of the adaptor sequences. we don't want to waste the sequencing $$ on the regions we don't want | |||
*The total size of the adaptors is 105bp, and there is another ~25bp of the capturing arm | |||
*The upper limit should be ~50bp above the lower limit | |||
=Overview= | =Overview= | ||
Line 43: | Line 48: | ||
| | | | ||
|} | |} | ||
Incubated at 37C for 30min, purified with Qiaquick columns, eluted with 40 ul EB. | |||
*Measure concentration with nanodrop | |||
===Size selection using Invitrogen 2% SizeSelect gel=== | |||
*Fill any unused well with 30ul EB Buffer | |||
*Mix 15ul EB buffer with 0.5ul ladder in a 0.2ml tube | |||
*Load 20u end-polished DNA sample into two lanes(use 3 or more lanes if the starting DNA is more than 1ug) | |||
*Run the SizeSelect program for 12~14 min. Pause when the 125bp band just move into the middle collection well | |||
*Use pipette to extract all solution in each of the sample well, and quickly refill the wells with 20ul EB. | |||
*Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube) | |||
*Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes. | |||
*Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour). | |||
===Ligation. Blunt-end and TA ligations use the same protocol but slightly different adaptor sequences.=== | |||
* Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time. | |||
{| {{table}} | |||
| ||ul | |||
|- | |||
| End-repaired & size selected DNA||36 | |||
|- | |||
| 40uM adaptor2||2 | |||
|- | |||
| 5X Quick Ligase Buffer||10 | |||
|- | |||
| Quick Ligase||2 | |||
|- | |||
| | |||
|} | |||
*Incubate at room temperature for 15 minutes, purified with MinElute columns, eluted with 22ul EB. | |||
===PCR of sequencing library=== | |||
Solexa_PCR_up: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | |||
AmpR6.3Sol: CAAGCAGAAGACGGCATACGAGCTCTTCGGAACGATGAGCCTCCAAC | |||
AmpF6.3rSol: CAAGCAGAAGACGGCATACGAGCTCTTCCAGATGTTATCGAGGTCCGA | |||
{| {{table}} | |||
| Ligation products||10||10 | |||
|- | |||
| 10uM solexa PCR up||2||2 | |||
|- | |||
| 10uM AmpR6.3Sol||2||- | |||
|- | |||
| 10uM AmpF6.3Sol||-||2 | |||
|- | |||
| 2X iProof master mix (Bio-Rad)||50||50 | |||
|- | |||
| 50X SYBR Green I||0.4||0.4 | |||
|- | |||
| H2O||36||36 | |||
|- | |||
| | |||
|} | |||
*Setup 2 master mix | |||
{| {{table}} | |||
| ||F||R | |||
|- | |||
| Ligation products|||| | |||
|- | |||
| 10uM solexa PCR up||13.2||13.2 | |||
|- | |||
| 10uM AmpR6.3Sol||13.2||- | |||
|- | |||
| 10uM AmpF6.3Sol||-||13.2 | |||
|- | |||
| 2X iProof master mix (Bio-Rad)||330||330 | |||
|- | |||
| 50X SYBR Green I||2.64||2.64 | |||
|- | |||
| H2O||237.6||237.6 | |||
|- | |||
| | |||
|} | |||
PCR program: 98 °C 30sec -> 8 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold. | |||
[[Image:20091112_125359.jpg]] | |||
* TBE Gel verification (10well) | |||
* 15ul h2o+4.5ul 6x loading dye+0.5ul 25bp ladder | |||
* 15ul h2o+3ul 6X loading dye+2ul sample | |||
[[Image:ZhangLab_2 2009-11-12 14hr 46min.jpg]] | |||
[[Image:ZhangLab_2 2009-11-12 14hr 48min.jpg]] | |||
*Mix the amplicons with two sets of primers, purified with Qiaquick columns with 32ul EB buffer | |||
==TBE Gel Size Selection== | |||
8-DF:46.3ng/ul | |||
9-DF:27.9ng/ul | |||
8-FS:30.6ng/ul | |||
9-FS:24.7ng/ul | |||
*Combining might lead to overload, run one gel for each library | |||
==Without Set CV-F== | |||
* Run samples in 3 lanes and ladder in 2 lanes in in a 5-well TBE gel | |||
* Load 2 lanes with 25bp ladder Mix in a .2ml tube(30ul H2O+9ul 6X loading dye+1ul 25bp ladder)/2 | |||
* Mix (30ul library + 15ul 6X loading dye + 15ul h20)/3 load to 3 wells |
Latest revision as of 03:21, 13 November 2009
Construction of Solexa sequencing library from padlock captured PCR products using NEBNext DNA Sample Prep Master Mix Set 1 Kit (E6040S/L)
- Info Read the FAQ!!!
- Protocol
- The NEBNext DNA SPMMS 1 (I) is compatible with protocols requiring a 3´ A overhang on the library molecules to facilitate ligation to adapters containing a 5´ T overhang, such as Illumina’s Genomic DNA Sample Prep protocol for the Genome Analyzer II.
- For 60bp run, we can use the library size of >180bp
- For 80bp runs, the lower limit for the sequencing libraries should be 200bp.
- If the library size is too small, some of the 80bp reads will reach to the other end of the adaptor sequences. we don't want to waste the sequencing $$ on the regions we don't want
- The total size of the adaptors is 105bp, and there is another ~25bp of the capturing arm
- The upper limit should be ~50bp above the lower limit
Overview[edit]
- Fragmentation and end-polishing
- Size Selection
- Ligation
- PCR of sequencing Library
- QPCR quantification
Fragmentation and end-polishing (Make blunt ends with 5'P)[edit]
- The PCR amplicons (200ng-1ug) are fragmented with Covaris sonicator to ~100bp
- End-Repair Reactions
Fragmented DNA | 85ul |
10X End Repair Bufer | 10ul |
End Repair Enzyme Mix | 5ul |
- Incubate tubes at RT for 30minutes.
- Perform a Qiaquick purification and elute with 39ul EB buffer.
- NOTE: For blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the chance of getting chimeric reads.
- A-Tailing Reactions
Blunet-end DNA | 37ul |
10X dA-Tailing Reaction Buffer | 5ul |
Klenow Fragment (3'-5' exo-) | 3ul |
H2O | 5ul |
Incubated at 37C for 30min, purified with Qiaquick columns, eluted with 40 ul EB.
- Measure concentration with nanodrop
Size selection using Invitrogen 2% SizeSelect gel[edit]
- Fill any unused well with 30ul EB Buffer
- Mix 15ul EB buffer with 0.5ul ladder in a 0.2ml tube
- Load 20u end-polished DNA sample into two lanes(use 3 or more lanes if the starting DNA is more than 1ug)
- Run the SizeSelect program for 12~14 min. Pause when the 125bp band just move into the middle collection well
- Use pipette to extract all solution in each of the sample well, and quickly refill the wells with 20ul EB.
- Resume the electrophoresis for additional 15sec, extract DNA and refill the wells with 20ul EB. *Resume the electrophoresis for additional 15sec, extract DNA (all the extracted DNA from the same sample are mixed in a tube)
- Refill the wells with 20ul EB, and run the electrophoresis for additional 3 minutes. Take a picture of the gel to document the extracted fragment sizes.
- Concentrate the DNA with a SpeedVac (no heat) to ~36ul (takes about 1hour).
Ligation. Blunt-end and TA ligations use the same protocol but slightly different adaptor sequences.[edit]
- Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time.
ul | |
End-repaired & size selected DNA | 36 |
40uM adaptor2 | 2 |
5X Quick Ligase Buffer | 10 |
Quick Ligase | 2 |
- Incubate at room temperature for 15 minutes, purified with MinElute columns, eluted with 22ul EB.
PCR of sequencing library[edit]
Solexa_PCR_up: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
AmpR6.3Sol: CAAGCAGAAGACGGCATACGAGCTCTTCGGAACGATGAGCCTCCAAC
AmpF6.3rSol: CAAGCAGAAGACGGCATACGAGCTCTTCCAGATGTTATCGAGGTCCGA
Ligation products | 10 | 10 |
10uM solexa PCR up | 2 | 2 |
10uM AmpR6.3Sol | 2 | - |
10uM AmpF6.3Sol | - | 2 |
2X iProof master mix (Bio-Rad) | 50 | 50 |
50X SYBR Green I | 0.4 | 0.4 |
H2O | 36 | 36 |
- Setup 2 master mix
F | R | |
Ligation products | ||
10uM solexa PCR up | 13.2 | 13.2 |
10uM AmpR6.3Sol | 13.2 | - |
10uM AmpF6.3Sol | - | 13.2 |
2X iProof master mix (Bio-Rad) | 330 | 330 |
50X SYBR Green I | 2.64 | 2.64 |
H2O | 237.6 | 237.6 |
PCR program: 98 °C 30sec -> 8 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold. File:20091112 125359.jpg
- TBE Gel verification (10well)
- 15ul h2o+4.5ul 6x loading dye+0.5ul 25bp ladder
- 15ul h2o+3ul 6X loading dye+2ul sample
File:ZhangLab 2 2009-11-12 14hr 46min.jpg File:ZhangLab 2 2009-11-12 14hr 48min.jpg
- Mix the amplicons with two sets of primers, purified with Qiaquick columns with 32ul EB buffer
TBE Gel Size Selection[edit]
8-DF:46.3ng/ul 9-DF:27.9ng/ul 8-FS:30.6ng/ul 9-FS:24.7ng/ul
- Combining might lead to overload, run one gel for each library
Without Set CV-F[edit]
* Run samples in 3 lanes and ladder in 2 lanes in in a 5-well TBE gel * Load 2 lanes with 25bp ladder Mix in a .2ml tube(30ul H2O+9ul 6X loading dye+1ul 25bp ladder)/2 * Mix (30ul library + 15ul 6X loading dye + 15ul h20)/3 load to 3 wells