Alice:LabNotes/2010-1-18: Difference between revisions
Jump to navigation
Jump to search
>Zsakura2 |
>Zsakura2 (→PCR) |
||
(One intermediate revision by the same user not shown) | |||
Line 69: | Line 69: | ||
purify the products with Minelute columns and elute in 15ul of EB. Then mix the two sets of products together. | purify the products with Minelute columns and elute in 15ul of EB. Then mix the two sets of products together. | ||
PAGE size selection : 200-275bp | PAGE size selection : 200-275bp | ||
[[File:ZhangLab_2 2010-01-21 11hr 27min.jpg]] | |||
Ethanol precipitation and elute in 20ul H2O | Ethanol precipitation and elute in 20ul H2O | ||
[[File:ZhangLab_2 2010-01-23 18hr 01min.jpg]] |
Latest revision as of 19:01, 28 January 2010
Solexa single-end sequencing library construction[edit]
- using NEBNext DNA Sample prep master mix I
- The PCR amplicons (200ng-1ug) are fragmented with Covaris sonicator to ~100bp-130bp.
- received the sheared capture products from Harvard in late Ocboter
End-repair Reactions[edit]
Fragmented DNA 85 ul 10X End Repair Reaction Buffer 10 ul End Repair Enzyme Mix 5 ul Keep the tube at room temperature (~20°C) for 30 minutes. Purify with Agencourt Ampure kit and elute in 40ul ddH2O Note: for blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the chance of getting chimeric reads.
Nanodrop result: PGP7: 16.3ng/ul
A-Tailing reactions[edit]
Blunt-end DNA 37 ul 10X dA-Tailing Reaction Buffer (10X) 5 ul Klenow Fragment (3’-5’ exo-) 3 ul H2O 5 ul Incubated at 37C for 30min purified the products with Agencourt Ampure kit and elute in 40ul ddH2O
Nanodrop: PGP7: 2.3ng/ul
adaptor ligation (1-21-10)[edit]
Prepare adaptors (need to be done only for the first time): Anneal adaptors by mixing 20 ul of 100 uM of the corresponding _up and _lo oligonucleotides (each) with 10ul 10X Taq buffer (or Stoffel buffer) and 50ul H2O, heating to 94C for 3 min, and then cool down to 20C at the rate of 0.1C/sec.
commonly used adaptors: Blunt-end adaptors: 5’NH2- ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’OH Solexa_1_up 3’NH2-ATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-5’OH Solexa_1_lo_nop TA adaptors (for the one adaptor protocol): 5- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3’OH PE_t_adapter 3-CTTCTGCCGTATGCTCGAGAAGGCTAG-5’Phos t_adaptor_rc_s regular Y adaptor: PE_t_adaptor(top) ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3'-Phosphorothioate bond PE_b_adaptor(bottom) \\5phos\\GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 5'-phosphorylation
Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time. adaptor:target molar ratio is 1:10~20
End-repaired & size selected DNA 36 ul 20uM TA adaptor 2 ul 5X Quick ligase buffer 10 ul Quick Ligase 2 ul
Incubate at room temperature for 15 minutes purify with Ampure kit and eluted with 40ul ddH2O
PCR[edit]
Ligation products 15 ul 15ul 10uM Solexa_PCR_up 2 ul 2ul 10uM AmpR6.3Sol 2 ul - 10uM AmpF6.3rSol - 2ul 2X iProof master mix (Bio-Rad) 50 ul 50ul 50X SYBR Green I 0.4ul 0.4ul H2O 21 ul 21ul PCR program: 98 °C 30sec -> 8 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold. purify the products with Minelute columns and elute in 15ul of EB. Then mix the two sets of products together. PAGE size selection : 200-275bp File:ZhangLab 2 2010-01-21 11hr 27min.jpg Ethanol precipitation and elute in 20ul H2O File:ZhangLab 2 2010-01-23 18hr 01min.jpg