Alice:LabNotes/2010-3-8: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Zsakura2
(Created page with '==Prepare genomic DNA for hybridization== *samples to be prepared: CVF-gDNA, CViB-gDNA, ===End-repair Reactions=== Fragmented DNA 85 ul 10X End R…')
 
>Zsakura2
Line 1: Line 1:
==Prepare genomic DNA for hybridization==
==Prepare genomic DNA for hybridization==
*samples to be prepared: CVF-gDNA, CViB-gDNA,  
*samples to be prepared: CVF-gDNA, CViB-gDNA,  
 
*two sheared gDNA received from Harvard: CD1 PGP1 ips P16 and PGP1F 8 gDNA


===End-repair Reactions===
===End-repair Reactions===

Revision as of 19:46, 8 March 2010

Prepare genomic DNA for hybridization

  • samples to be prepared: CVF-gDNA, CViB-gDNA,
  • two sheared gDNA received from Harvard: CD1 PGP1 ips P16 and PGP1F 8 gDNA

End-repair Reactions

Fragmented DNA                             85 ul
10X End Repair Reaction Buffer             10 ul
End Repair Enzyme Mix                      5  ul
Keep the tube at room temperature (~20°C) for 30 minutes.
Purify with Qiaquick column and elute in 40ul ddH2O
Note: for blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the
chance of getting chimeric reads.


A-Tailing reactions

Blunt-end DNA                             37 ul
10X dA-Tailing Reaction Buffer (10X)       5 ul
Klenow Fragment (3’-5’ exo-)               3 ul
H2O                                        5 ul
Incubated at 37C for 30min
purified the products with Qiaquick column and elute in 40ul ddH2O

adaptor ligation

Prepare adaptors (need to be done only for the first time): 
100uM PE-t: 20ul
100uM PE-b: 20ul
10x stoffel buffer:  10ul
H2O:        50ul
94C for 3 min, and then cool down to 20C at the rate of 0.1C/sec. 
commonly used adaptors:
Blunt-end adaptors:
5’NH2- ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’OH	 	Solexa_1_up
3’NH2-ATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-5’OH	        Solexa_1_lo_nop

TA adaptors (for the one adaptor protocol):
5- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3’OH		PE_t_adapter
3-CTTCTGCCGTATGCTCGAGAAGGCTAG-5’Phos	                t_adaptor_rc_s

regular Y adaptor:
PE_t_adaptor(top)              ACACTCTTTCCCTACACGACGCTCTTCCGATC*T              3'-Phosphorothioate bond	
PE_b_adaptor(bottom)           \\5phos\\GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG       5'-phosphorylation	
Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw 
cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time. 
adaptor:target molar ratio is 1:10~20
A-tailed DNA                               10 ul
20uM Y adaptor                             3 ul 
5X Quick ligase buffer                     10 ul  
Quick Ligase                                3 ul
H2O                                        24 ul                                                 
Incubate at room temperature for 15 minutes
purify the product with Agencourt AMpure kit and elute in 40ul ddH2O

PCR

Ligation products                 5ul      (8 well for each set, total of 80 well) 
100uM Solexa_PCR_up               0.2ul        
100uM solexa_PCR-lo               0.2ul
2X phusion HF master mix          50ul     
50X SYBR Green I                  0.4ul      
H2O                               45ul       
PCR program: 98 °C 30sec  -> 13 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold. 
purify the products with Qiagen Qiaquick columns and elute in 40ul ddH2O