Alice:LabNotes/2010-8-5: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Zsakura2
(Created page with '=Prepare genomic DNA for hybridization (for use with Nimblegen's kit)= *the following samples will be processed: **KiPS **Human HUVEC, HUViPS 4F-1, HUViPS 4F-3 **FiPS *Note: HU…')
 
>Zsakura2
(Blanked the page)
 
Line 1: Line 1:
=Prepare genomic DNA for hybridization (for use with Nimblegen's kit)=
*the following samples will be processed:
**KiPS
**Human HUVEC, HUViPS 4F-1, HUViPS 4F-3
**FiPS


*Note: HUV ips 4F-3 came back with only 70ul, therefore i added 15ul of ddH2O to it. The rest of the samples were around 85-90 ul
===End-repair Reactions===
Fragmented DNA                            85 ul
10X End Repair Reaction Buffer            10 ul
End Repair Enzyme Mix                      5  ul
Keep the tube at room temperature (~20°C) for 30 minutes.
Purify with Qiaquick column and elute in 40ul ddH2O
Note: for blunt-end ligation, the A-Tailing reaction should be skipped. Doing TA ligation is preferable since it eliminates the
chance of getting chimeric reads.
*Nanodrop result (40ul total for each):
===A-Tailing reactions (done on 5/22/2010)===
Blunt-end DNA                            40 ul
10X dA-Tailing Reaction Buffer (10X)      5 ul
Klenow Fragment (3’-5’ exo-)              2 ul
H2O                                      3  ul
Incubated at 37C for 30min
purified the products with Qiaquick column and elute in 40ul ddH2O
*Nanodrop result (40ul total for each):
===adaptor ligation===
Prepare adaptors (need to be done only for the first time):
100uM PE-t: 20ul
100uM PE-b: 20ul
10x stoffel buffer:  10ul
H2O:        50ul
94C for 3 min, and then cool down to 20C at the rate of 0.1C/sec.
commonly used adaptors:
Blunt-end adaptors:
5’NH2- ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’OH Solexa_1_up
3’NH2-ATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-5’OH         Solexa_1_lo_nop
TA adaptors (for the one adaptor protocol):
5- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3’OH PE_t_adapter
3-CTTCTGCCGTATGCTCGAGAAGGCTAG-5’Phos                 t_adaptor_rc_s
regular Y adaptor:
PE_t_adaptor(top)              ACACTCTTTCCCTACACGACGCTCTTCCGATC*T              3'-Phosphorothioate bond
PE_b_adaptor(bottom)          \\5phos\\GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG      5'-phosphorylation
Set up ligation reaction. Note that the ATP in the Quick Ligase buffer hydrolyzes very quickly after several rounds of freeze/thaw
cycles, so it’s a good idea to make small aliquots of a fresh tube of Quick Ligase Buffer, and use one small aliquot each time.
adaptor:target molar ratio is 1:10~20
For HVEC, HUV ips 4F1, HUV ips 4F3:
A-tailed DNA                        40 ul
20uM Y adaptor                        2 ul
5X Quick ligase buffer              10 ul 
Quick Ligase                          2 ul   
For HFFxF, Fips 3F#1:
A-tailed DNA                      20 ul
20uM Y adaptor                      3 ul
5X Quick ligase buffer            10 ul 
Quick Ligase                        2 ul
H2O                                15 ul
For KERAT, Kips 4F#8:
A-tailed DNA                  20 ul
20uM Y adaptor                  5 ul
5X Quick ligase buffer        10 ul 
Quick Ligase                    2 ul
H2O                            13 ul
Incubate at room temperature for 20 minutes
purify the product with Agencourt AMpure kit and elute in 40ul ddH2O for HVEC, HUV ips 4F1, HUV ips 4F3 (60ul for the rest)
===PCR amplification===
Ligation products                10ul   
100uM PCR_F                      0.2ul       
100uM PCR_R                      0.2ul
2X phusion HF master mix          50ul   
50X SYBR Green I                  0.4ul     
H2O                              45ul     
PCR program: 98 °C 30sec  -> 7 cycles of (98°C 10sec -> 60°C 20 sec -> 72°C 15sec) -> 72°C 3min ->15°C hold.
purify the products with Ampure beads and elute in 160ul for 3 HUVEC lines, and 240ul for the rest
*nanodrop result:

Latest revision as of 01:08, 15 August 2010