Kun:LabNotes/CpgSeq: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
mNo edit summary
Line 43: Line 43:
   Chr19:  first 3,857
   Chr19:  first 3,857
   
   
*First oligo library (Cpg28k) includes chr6(9,875), chr20(6197), chr22(5358) and part of chrX(6558 of 8139).
 
**[[Media:Cpg28kV1_probes.gz|Probe information file.]]
**[[Media:Cpg28kV1_probes.gz|Probe information file.]]
**[[Media:Cpg28kV1.txt|Probe raw sequences.]]
**[[Media:Cpg28kV1.txt|Probe raw sequences.]]

Revision as of 07:38, 10 April 2008

2008 <calendar> name=Kun:LabNotes/CpgSeq format=%name/%year-%month-%day date=2008/02/01 view=oneyear </calendar> 2007 <calendar> name=Kun:LabNotes/CpgSeq format=%name/%year-%month-%day date=2007/11/01 view=threemonths </calendar>

Probe design

Column synthesized probes (36)

  • Kun:LabNotes/CpgSeq/2007-10-12: probe = revcomp(RP) + linker + FP
  • Just realized that there was a mistake in probe design (11-20-2007). I assumed that after bisulfite treatment, the two strands are still complementary, which is not true. The probes have to be designed based on one strand only. If the forward PCR primers contain no "C" and the reverse primers contain no "G", that means the target strand is the forward strand. In that case, the padlock probes should be: revcomp(FP) + linker + RP. Here are the revised perl scripts: first 24 primers; second 12 primers. Here is the new probe file.

Agilent probes, V1

  • Several considerations in this design include:
    • Degenerate bases: I allowed at most two degenerate bases per primer. To convert PCR primers to padlock probes, multiple probes will be designed for one primer pair in order to cover all combinations.
    • Gap size: The range of amplicon size is 225-275bp, so the gap size is approximately 185-225bp.
    • Amplification adaptors: Version 4; Linker sequences: Version 7
   AP1: GTAGACTGGAAGAGCACTGTT  V4
   AP2: GATCGGATACGCATGAGGCTA  V4
   Linker: GTTGGAGGCTCATCGTTCCTATTCAGCTGCAGATGTTATCGAGGTCCGAC
           ------                  ----                ------
           Mme I                   Alu I                Mme I
   
  • Here is the perl code for primer design. The input file is cpgIslandExt.txt downloaded from UCSC GoldenPath database.
  • Conversion of PCR primers to padlock probes: AP1 + revcomp(FP) + linker + RP + AP2. codes.
  Some statistics
  Total probes:                     210,498
  Total CpG islands:                 23,496
  Total non-overlapping regions: 12,037,010 bps
  Total captured sequences:      13,291,608 bps
  ===CpgMIP28k set===
          probes         CpG islands
  Chr6:   9,875          3,028
  Chr20:  6,197          1,930
  Chr21:  2,619            809
  Chr22:  5,358          1,664
  Chr19:  first 3,857