AlanFung:LabNotes/CTCF/2011-6-17: Difference between revisions
Jump to navigation
Jump to search
>Alan6017518 |
>Alan6017518 |
||
Line 1: | Line 1: | ||
==Objective== | ==Objective== | ||
*Perform Sanger Sequencing on library prepared by Methyl-Seq DNA Sample Prep Kit | *Perform Sanger Sequencing on library prepared by Methyl-Seq DNA Sample Prep Kit Sample D 2011-5-16 [[http://genome-tech.ucsd.edu/LabNotes/index.php/AlanFung:LabNotes/CTCF/2011-5-16]] | ||
*Ensure the library is well constructed and that we are able to generate what Epicenter claimed to be the problem | *Ensure the library is well constructed and that we are able to generate what Epicenter claimed to be the problem | ||
==Protocol== | ==Protocol== | ||
==TA Cloning== | ==TA Cloning== |
Revision as of 22:17, 17 June 2011
Objective
- Perform Sanger Sequencing on library prepared by Methyl-Seq DNA Sample Prep Kit Sample D 2011-5-16 [[1]]
- Ensure the library is well constructed and that we are able to generate what Epicenter claimed to be the problem
Protocol
TA Cloning
Ligation of PCR vector
Transformation
PCR amplification and preparation for Sanger Sequencing
File:ZhangLab 2 2011-06-16 16hr 31min.jpg
- Picked clone #1-6 for sanger sequencing
Sequencing Results
- #5 failed to pass the QC due to non specific results
Results
Analysis Clone #1-6 with blast
- Extract Sequence by 4peaks (Hit the info button>sequence)
- All clones starts with bunch of Ns and this sequence
gggcgattgggccctctagatgcatgctcgagcggccgccagtgtgatggatatctgcagaattcggct
- Clones 1, 2, and 3 contains illumina-compatible transposome (Methyl-Seq Tagmentation Mix)
CTGTCTCTTATACACATCT