AlanFung:LabNotes/CTCF/2011-6-17: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Alan6017518
>Alan6017518
Line 1: Line 1:
==Objective==
==Objective==
*Perform Sanger Sequencing on library prepared by Methyl-Seq DNA Sample Prep Kit
*Perform Sanger Sequencing on library prepared by Methyl-Seq DNA Sample Prep Kit Sample D 2011-5-16 [[http://genome-tech.ucsd.edu/LabNotes/index.php/AlanFung:LabNotes/CTCF/2011-5-16]]
*Ensure the library is well constructed and that we are able to generate what Epicenter claimed to be the problem
*Ensure the library is well constructed and that we are able to generate what Epicenter claimed to be the problem
==Protocol==
==Protocol==
==TA Cloning==
==TA Cloning==

Revision as of 22:17, 17 June 2011

Objective

  • Perform Sanger Sequencing on library prepared by Methyl-Seq DNA Sample Prep Kit Sample D 2011-5-16 [[1]]
  • Ensure the library is well constructed and that we are able to generate what Epicenter claimed to be the problem

Protocol

TA Cloning

Ligation of PCR vector

Transformation

PCR amplification and preparation for Sanger Sequencing

File:ZhangLab 2 2011-06-16 16hr 31min.jpg

  • Picked clone #1-6 for sanger sequencing

Sequencing Results

Media:06172011_ab1.zip

  • #5 failed to pass the QC due to non specific results

Results

Analysis Clone #1-6 with blast

  • Extract Sequence by 4peaks (Hit the info button>sequence)
  • All clones starts with bunch of Ns and this sequence
gggcgattgggccctctagatgcatgctcgagcggccgccagtgtgatggatatctgcagaattcggct
  • Clones 1, 2, and 3 contains illumina-compatible transposome (Methyl-Seq Tagmentation Mix)
CTGTCTCTTATACACATCT