Noi/NOTES/2011-10-6: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Noi
>Noi
Line 30: Line 30:
** The first five cycles, Tm of each primer was calculated without 5 nt overhang, then the Tm was increased based on the Tm of the full length primer
** The first five cycles, Tm of each primer was calculated without 5 nt overhang, then the Tm was increased based on the Tm of the full length primer
** The number of cycles will be monitored
** The number of cycles will be monitored
[[File:Expansion-PCR_2011_10_07.png| 400px]]
* Purified with Qiaquick column (2 columns) and elute with EB buffer volume 50ul each --> total volume = 100ul
* Purified with Qiaquick column (2 columns) and elute with EB buffer volume 50ul each --> total volume = 100ul
* Measure DNA conc. with Nanodrop: 18ng/ul or 295.5nM  
* Measure DNA conc. with Nanodrop: 18ng/ul or 295.5nM  

Revision as of 01:46, 8 October 2011

Plan of probe (from LC Bioscience) production

  • Follow the protocol: [1] and standard protocol using to make DMR330k probe set
  • After receiving the probes, resuspend with H2O to the concentration 20 nM (in case it is lyophilized)
  • perform expansion PCR to amplify the probes as the template

Expansion PCR

Components Volume (ul) Final conc.
20nM LC Sciences Oligoes 10.00 1nM
eMIP_CA1_F (100uM) 0.80 400nM
eMIP_CA1_F (100uM) 0.80 400nM
2x Kapa SYBG MM 100.00 1x
H2O 88.40
Total 200.00

Program
95C 30sec -> (95C 5sec -> 52C 60sec-> 72C 30sec) x 5 -> (95C 5sec -> 60C 30sec-> 72C 30sec) x 10 -> 72C 2min -> 15C hold

  • Primer info.
    • eMIP_CA1_F: TGCCTAGGACCGGATCAACT (TGCCT overhang), Tm of the short one = 53.06C, the long one = 63.28C
    • eMIP_CA1_R: GAGCTTCGGTTCACGCAATG (GAGCT overhang), Tm of the short one = 54.41C, the long one = 62.95C
  • Note:
    • The first five cycles, Tm of each primer was calculated without 5 nt overhang, then the Tm was increased based on the Tm of the full length primer
    • The number of cycles will be monitored

File:Expansion-PCR 2011 10 07.png

  • Purified with Qiaquick column (2 columns) and elute with EB buffer volume 50ul each --> total volume = 100ul
  • Measure DNA conc. with Nanodrop: 18ng/ul or 295.5nM
  • Dilute 1st round amplicon to 10nM volume 1000ul (mix 33.89ul of 295.5nM 1st round amplicon with 966.11ul H2O)--> for using as the template for the future amplification
  • Perform production PCR

Production PCR

Components 1 rxn 32x rxn mix
1st round amplicon (10nM) 0.20 6.40
eMIP_CA1_F (100uM) 0.40 12.80
eMIP_CA1_R (100uM) 0.40 12.80
2x Kapa SYBG MM 50.00 1600.00
H2O 49.00 1568.00
Total 100.00 3200.00

Program
95C 30sec -> (95C 5sec -> 60C 30sec-> 72C 20sec) x 13 -> 72C 2min -> 15C hold

  • The number of cycles will be monitored to prevent overamplification