Noi/NOTES/2011-10-6: Difference between revisions
Jump to navigation
Jump to search
>Noi |
>Noi |
||
Line 30: | Line 30: | ||
** The first five cycles, Tm of each primer was calculated without 5 nt overhang, then the Tm was increased based on the Tm of the full length primer | ** The first five cycles, Tm of each primer was calculated without 5 nt overhang, then the Tm was increased based on the Tm of the full length primer | ||
** The number of cycles will be monitored | ** The number of cycles will be monitored | ||
[[File:Expansion-PCR_2011_10_07.png| 400px]] | |||
* Purified with Qiaquick column (2 columns) and elute with EB buffer volume 50ul each --> total volume = 100ul | * Purified with Qiaquick column (2 columns) and elute with EB buffer volume 50ul each --> total volume = 100ul | ||
* Measure DNA conc. with Nanodrop: 18ng/ul or 295.5nM | * Measure DNA conc. with Nanodrop: 18ng/ul or 295.5nM |
Revision as of 01:46, 8 October 2011
Plan of probe (from LC Bioscience) production
- Follow the protocol: [1] and standard protocol using to make DMR330k probe set
- After receiving the probes, resuspend with H2O to the concentration 20 nM (in case it is lyophilized)
- perform expansion PCR to amplify the probes as the template
Expansion PCR
Components | Volume (ul) | Final conc. |
20nM LC Sciences Oligoes | 10.00 | 1nM |
eMIP_CA1_F (100uM) | 0.80 | 400nM |
eMIP_CA1_F (100uM) | 0.80 | 400nM |
2x Kapa SYBG MM | 100.00 | 1x |
H2O | 88.40 | |
Total | 200.00 |
Program
95C 30sec -> (95C 5sec -> 52C 60sec-> 72C 30sec) x 5 -> (95C 5sec -> 60C 30sec-> 72C 30sec) x 10 -> 72C 2min -> 15C hold
- Primer info.
- eMIP_CA1_F: TGCCTAGGACCGGATCAACT (TGCCT overhang), Tm of the short one = 53.06C, the long one = 63.28C
- eMIP_CA1_R: GAGCTTCGGTTCACGCAATG (GAGCT overhang), Tm of the short one = 54.41C, the long one = 62.95C
- Note:
- The first five cycles, Tm of each primer was calculated without 5 nt overhang, then the Tm was increased based on the Tm of the full length primer
- The number of cycles will be monitored
File:Expansion-PCR 2011 10 07.png
- Purified with Qiaquick column (2 columns) and elute with EB buffer volume 50ul each --> total volume = 100ul
- Measure DNA conc. with Nanodrop: 18ng/ul or 295.5nM
- Dilute 1st round amplicon to 10nM volume 1000ul (mix 33.89ul of 295.5nM 1st round amplicon with 966.11ul H2O)--> for using as the template for the future amplification
- Perform production PCR
Production PCR
Components | 1 rxn | 32x rxn mix |
1st round amplicon (10nM) | 0.20 | 6.40 |
eMIP_CA1_F (100uM) | 0.40 | 12.80 |
eMIP_CA1_R (100uM) | 0.40 | 12.80 |
2x Kapa SYBG MM | 50.00 | 1600.00 |
H2O | 49.00 | 1568.00 |
Total | 100.00 | 3200.00 |
Program
95C 30sec -> (95C 5sec -> 60C 30sec-> 72C 20sec) x 13 -> 72C 2min -> 15C hold
- The number of cycles will be monitored to prevent overamplification