Brandon:LabNotes/Project1/2012-10-26: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Bsos
>Bsos
Line 10: Line 10:




*to further show abilities and limitations of Nextera method, 10K 100K and 500K cells will be used with nextera tagmentation protocol. Increased amounts of nextera transposomes will be used with each cellular amount since it has been observed lower cellular concentrations have better nextera transposome integration with more nextera transposomes.  
*to further show abilities and limitations of Nextera method, 10K, 50K and 150K cells will be used with nextera tagmentation protocol. Increased amounts of nextera transposomes will be used with each cellular amount since it has been observed lower cellular concentrations have better nextera transposome integration with higher transposomes/cells ratio.




Line 20: Line 20:


*Improvements from last assay
*Improvements from last assay
**GM12878 DNA will be purified from GM12878 using RNase and Protease. (highly accessible regions are still highly accesilbe in pure DNA samples)
**GM12878 DNA will be purified from GM12878 using RNase A (or Rnase mixture) and Protease AND proteinase K. Highly accessible regions are still highly accessible in pure DNA samples, want want to ensure proteins are not bound and RNA is not interfering. If those regions are still accessible then dunno why..






'''Why using RNAase III for fragmentation'''
'''Why using RNAase III for fragmentation'''
*Rnase III creates 5'-PO4 and 3'-OH termini on the fragments  
*Rnase III creates 5'-PO4 and 3'-OH termini on the fragments
*however, Cuts ONLY dsRNA (used DNA blocking primer to block that)
*however, Cuts ONLY dsRNA (used DNA blocking primer to block that)
*Preferentially cuts from 5’ and 3’ ends (used blocking primer)
*Preferentially cuts from 5’ and 3’ ends (used blocking primer)
Line 81: Line 81:




2. Purify GM12878 DNA from GM12878 cells with DNeasy blood and tissue kit for cells (USE PROTEINASE AND RNAase). quanititate DNA with nanodrop.
2. Purify GM12878 DNA from GM12878 cells with DNeasy blood and tissue kit for cells (USE PROTEINASE K (invitrogen) AND protease (qiagen) AND RNAase A). quanititate DNA with nanodrop.




Line 111: Line 111:
===Nextera Tagmentation Protocol===
===Nextera Tagmentation Protocol===


1. See step 3 in IVT protocol. Do the cell lysis section for the "nextera tagmentation samples", samples 7-12,20.
1. See step 3 in IVT protocol. Do the cell lysis section for the "nextera tagmentation samples", samples 7-12,20,22.




Line 134: Line 134:
|  100 || 0.6 ||1 uL, 1/10 dltd enz  
|  100 || 0.6 ||1 uL, 1/10 dltd enz  
|-
|-
| 60 ng pure|| 60.000000 ||1 uL not diluted
| 60 ng pure|| 60 ||1 uL not diluted
|-
|-
| 6 ng pure|| 6 ||3 uL 1/5 dltd enz  
| 6 ng pure|| 6 ||1 uL, 1/10 dltd enz  
|-
|-
| 3 ng pure|| 3 ||2 uL 1/5 dltd enz  
| 3 ng pure|| 3 ||1 uL, 1/10 dltd enz  
|-
|-
| 600 pg pure|| 0.6 ||1 uL, 1/10 dltd enz  
| 600 pg pure|| 0.6 ||1 uL, 1/10 dltd enz  
Line 156: Line 156:




3. Protease digestion of transposition reactions.
3. Protease (Qiagen) digestion of transposition reactions.
  To each tube, add:
  To each tube, add:
  1 uL  Qiagen Protease, for 5 uL reaction 1 uL of .5 for .1 AU final. (stock is 5 AU and diluted 10X. want .5 AU/uL final [])
  1 uL  Qiagen Protease, for 5 uL reaction 1 uL of .5 for .1 AU final. (stock is 5 AU and diluted 10X. want .5 AU/uL final [])
Line 191: Line 191:
   
   
  Barcodes to use:
  Barcodes to use:
  Index 55, Nxtra atpr 7.  1000 cells nextera tagmentation
  Index 55, NX adaptor 7.  150K cells nextera tagmentation
  Index 56, Nxtra atpr 8.  500  cells nextera tagmentation
  Index 56, NX adaptor 8.  50K cells nextera tagmentation
  Index 57, Nxtra atpr 9.  100 cells nextera tagmentation
  Index 57, NX adaptor 9.  10K cells nextera tagmentation
  Index 58, Nxtra atpr 10. 6  ng purified DNA nextera tagmentation
  Index 58, NX adaptor 10. 1000 cells nextera tagmentation
  Index 59, Nxtra atpr 11. 600 pg purified DNA nextera tagmentation
  Index 59, NX adaptor 11. 500  cells nextera tagmentation
  Index 60, Nxtra atpr 12. 60 pg purified DNA nextera tagmentation
  Index 60, NX adaptor 12. 100 cells nextera tagmentation
  Index 62, Nxtra atpr 14. 1000 cells MEFs nextera tagmentation
  Index 61, NX adaptor 13. 60  ng purified DNA nextera tagmentation
  Index 66, Nxtra atpr 18. 1000 cells lysed without transposome complex nextera tagmentation
  Index 62, NX adaptor 14. 6  ng purified DNA nextera tagmentation
  Index 67, Nxtra atpr 19. pure DNA only (6 ng) nextera tagmentation
  Index 63, NX adaptor 15. 3  ng purified DNA nextera tagmentation
  Index 68, Nxtra atpr 20. Nuclease free H20 only nextera tagmentation
  Index 64, NX adaptor 16. 600  pg purified DNA nextera tagmentation
   
   
Index 68, NX adaptor  20. 1000 cells lysed without transposome complex nextera tagmentation
Index 69, NX adaptor  21. pure DNA only (6 ng) nextera tagmentation
Index 70, NX adaptor  22. Nuclease free H20 only nextera tagmentation
  add the following to above dry tube:
  add the following to above dry tube:
  25 uL KAPA HF mix (used KAPA SYBR FAST qPCR mix instead)
  25 uL KAPA HF mix (used KAPA SYBR FAST qPCR mix instead)
Line 249: Line 253:
  3.  100  cells IVT
  3.  100  cells IVT
  4.  6  ng purified DNA IVT
  4.  6  ng purified DNA IVT
  5.  600 pg purified DNA IVT
  5.  3  ng purified DNA IVT
  6.  60  pg purified DNA IVT
  6.  600 pg purified DNA IVT
  13. 1000 cells MEFs IVT
  17. 1000 cells lysed without transposome complex IVT
15. 1000 cells lysed without transposome complex IVT
  18. pure DNA only (6 ng) IVT
  16. pure DNA only (6 ng) IVT
  19. Nuclease free H20 only IVT
  17. Nuclease free H20 only IVT
 




*Make 10ml 10X lysis buffer (LB, 100mM Tris.Hcl pH 7.5, 100mM NaCl, 30mM MgCl2, 1% NP40, Crawford et al. PNAS 2003) in nuclease free H2O.  
*Make 10ml 10X lysis buffer (LB, 100mM Tris.Hcl pH 7.5, 100mM NaCl, 30mM MgCl2, 1% NP40, Crawford et al. PNAS 2003) in nuclease free H2O.  
*Prepare aliquots of lymphocytes GM12878 (have GM20431, GM12878 and MEFs) that contain 1000, 500, 100 cells.
*Prepare aliquots of lymphocytes GM12878 (have GM20431, GM12878, MEFs) that contain 1000, 500, 100 cells.
**spin down cells to concentrate them as necessary.
**spin down cells to concentrate them as necessary.
*Prepare 2X LB from 10X buffer. mineral oil optional.
*Prepare 2X LB from 10X buffer. mineral oil optional.
*if needed make 4 or 6 uL solutions. keep 1:1 ratio of cells:lysis buffer
*if needed make 4 or 6 uL solutions. keep 1:1 ratio of cells:lysis buffer
*make each cellular concentration in triplicate for AluI amplification with PCR for cell number quantification! store samples and perform quantification later. Use pure DNA nanodropped controls!!
AluI PCR quant
5 uL AluI 245-263 primer
5 uL AluI 21-40 primer
X sample
X water
_________
50 uL


*incubate below mixtures at 37C for 30 mins.
*incubate below mixtures at 37C for 30 mins.
Line 269: Line 283:
| align="center" style="background:#f0f0f0;"|'''2. 500 IVT'''
| align="center" style="background:#f0f0f0;"|'''2. 500 IVT'''
| align="center" style="background:#f0f0f0;"|'''3. 100 IVT'''
| align="center" style="background:#f0f0f0;"|'''3. 100 IVT'''
| align="center" style="background:#f0f0f0;"|'''7. 1K nxta'''
| align="center" style="background:#f0f0f0;"|'''7. 150K nxta'''
| align="center" style="background:#f0f0f0;"|'''8. 500 nxta'''
| align="center" style="background:#f0f0f0;"|'''8. 50K nxta'''
| align="center" style="background:#f0f0f0;"|'''9. 100 nxta'''
| align="center" style="background:#f0f0f0;"|'''9. 10K nxta'''
| align="center" style="background:#f0f0f0;"|'''13. 1K MEF IVT'''
| align="center" style="background:#f0f0f0;"|'''10. 1K nxta'''
| align="center" style="background:#f0f0f0;"|'''14. 1K MEF nxta'''
| align="center" style="background:#f0f0f0;"|'''11. 500 nxta'''
| align="center" style="background:#f0f0f0;"|'''15. 1K IVT con'''
| align="center" style="background:#f0f0f0;"|'''12. 100 nxta'''
| align="center" style="background:#f0f0f0;"|'''17. NTC IVT'''
| align="center" style="background:#f0f0f0;"|'''17. 1K IVT con'''
| align="center" style="background:#f0f0f0;"|'''18. 1K nxta con'''
| align="center" style="background:#f0f0f0;"|'''19. NTC IVT'''
| align="center" style="background:#f0f0f0;"|'''20. NTC nxta'''
| align="center" style="background:#f0f0f0;"|'''20. 1K nxta con'''
| align="center" style="background:#f0f0f0;"|'''22. NTC nxta'''
|-
|-
| cells||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul PBS||1 ul||1 ul PBS
| cells||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul PBS||1 ul||1 ul PBS
|-
|-
| 2X LB||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul
| 2X LB||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul||1 ul
|-
|-
|  
|  
Line 343: Line 358:


8. Clean RNA with with Zymo RNA Clean & Concentrator-5 Kit
8. Clean RNA with with Zymo RNA Clean & Concentrator-5 Kit
*can quantitate with Qubit if needed
*can quantitate with Qubit if needed, and run TBU-gel




Line 374: Line 389:




10. (ONLY DID ZYMO CLEANUP, STILL WORKED FINE 2012/08/28 update) DNase I digestion and Zymo RNA clean and concentrator cleanup. removes dsDNA. does not remove ss or DNA:RNA hybrids at high efficiency, 1:500 that of dsDNA. better than nothing...
10. Zymo RNA clean and concentrator cleanup.  
*Resuspend in appropriate volume in nuclease free H2O.
*Resuspend in appropriate volume in nuclease free H2O (12 uL last time)
*not doing protease digestion since seems it wasnt as effective in previous [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:LabNotes/Project1/2012-6-6 RNase III fragmentation]
*not doing protease digestion after RNA fragmentation since seems it wasn't as effective in previous [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:LabNotes/Project1/2012-6-6 RNase III fragmentation]
 




11. Quanitate RNA with QUbit


 
11. Poly(A) Addition with polyA polymerase (Enzymatics)
12. Poly(A) Addition with polyA polymerase (Enzymatics)
*enzymatics PolyA polymerase.
*enzymatics PolyA polymerase.


Line 399: Line 411:




13. single strand synthesis MMLV RT (Clontech)
12. single strand synthesis MMLV RT (Clontech)


*Followed protocol for [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:Protocols/SMART_MMLV_RT SMART MMLV Reverse Transcriptase]
*Followed protocol for [http://genome-tech.ucsd.edu/LabNotes/index.php/Brandon:Protocols/SMART_MMLV_RT SMART MMLV Reverse Transcriptase]
Line 426: Line 438:




14. second strand synthesis (qPCR) (KAPA), addition of barcodes
13. second strand synthesis (qPCR) (KAPA), addition of barcodes
  Samples:
  Samples:
  Index 49, N2 adaptor  1.  1000 cells IVT
  Index 49, N2 adaptor  1.  1000 cells IVT
Line 432: Line 444:
  Index 51, N2 adaptor  3.  100  cells IVT
  Index 51, N2 adaptor  3.  100  cells IVT
  Index 52, N2 adaptor  4.  6  ng purified DNA IVT
  Index 52, N2 adaptor  4.  6  ng purified DNA IVT
  Index 53, N2 adaptor  5.  600 pg purified DNA IVT
  Index 53, N2 adaptor  5.  3  ng purified DNA IVT
  Index 54, N2 adaptor  6.  60  pg purified DNA IVT
  Index 54, N2 adaptor  6.  600 pg purified DNA IVT
  Index 61, N2 adaptor  13. 1000 cells MEFs IVT
   
  Index 63, N2 adaptor  15. 1000 cells lysed without transposome complex IVT
  Index 65, N2 adaptor  17. 1000 cells lysed without transposome complex IVT
  Index 64, N2 adaptor  16. pure DNA only (6 ng) IVT
  Index 66, N2 adaptor  18. pure DNA only (6 ng) IVT
  Index 65, N2 adaptor  17. Nuclease free H20 only IVT
  Index 67, N2 adaptor  19. Nuclease free H20 only IVT
 
   
   
  KAPA SYBR FAST qPCR mix until saturation, X35 cycles
  KAPA SYBR FAST qPCR mix until saturation, X35 cycles
   
   
  25 uL KAPA SYBR
  25 uL KAPA SYBR FAST qPCR mix
  4    uL primers, 2 uL F, 2 uL R (T7-top2-PCR-iaf or T7-top3-PCR-iaf) and (PCR_R.N2Ind[XX])
  4    uL primers, 2 uL F, 2 uL R (T7-top2-PCR-iaf or T7-top3-PCR-iaf) and (PCR_R.N2Ind[XX])
  1  uL H2O
  1  uL H2O
Line 452: Line 465:




15.qiaquick cleanup
14.qiaquick cleanup
*can quanitate with nanodrop
*can quanitate with nanodrop
*run qiaquick to clean sample before performing qPCR.




16. Gel Size selection
15. Gel Size selection
*gel size select from 400-800 bp, follow gel size selection protocol
*gel size select from 400-800 bp, follow gel size selection protocol
*do not need to include controls.
*do not need to include controls.




17. Cloning and Transformation, then genewiz sequencing for verification of inserts
16. Cloning and Transformation, then genewiz sequencing for verification of inserts




18. Submit for sequencing if genewiz sequencing checks out.
17. Submit for sequencing if genewiz sequencing checks out.


===Results===
===Results===
Line 559: Line 570:
  Index 51, N2 adaptor  3.  100  cells IVT
  Index 51, N2 adaptor  3.  100  cells IVT
  Index 52, N2 adaptor  4.  6  ng purified DNA IVT
  Index 52, N2 adaptor  4.  6  ng purified DNA IVT
  Index 53, N2 adaptor  5.  600 pg purified DNA IVT
  Index 53, N2 adaptor  5.  3  ng purified DNA IVT
  Index 54, N2 adaptor  6.  60  pg purified DNA IVT
  Index 54, N2 adaptor  6.  600 pg purified DNA IVT
  Index 55, Nxtra atpr 7.  1000 cells nextera tagmentation
  Index 55, NX adaptor 7.  150K cells nextera tagmentation
  Index 56, Nxtra atpr 8.  500  cells nextera tagmentation
  Index 56, NX adaptor 8.  50K cells nextera tagmentation
  Index 57, Nxtra atpr 9.  100 cells nextera tagmentation
  Index 57, NX adaptor 9.  10K cells nextera tagmentation
  Index 58, Nxtra atpr 10. 6  ng purified DNA nextera tagmentation
  Index 58, NX adaptor 10. 1000 cells nextera tagmentation
  Index 59, Nxtra atpr 11. 600 pg purified DNA nextera tagmentation
  Index 59, NX adaptor 11. 500  cells nextera tagmentation
  Index 60, Nxtra atpr 12. 60 pg purified DNA nextera tagmentation
  Index 60, NX adaptor 12. 100 cells nextera tagmentation
  Index 61, N2 adaptor  13. 1000 cells MEFs IVT
  Index 61, NX adaptor  13. 60  ng purified DNA nextera tagmentation
  Index 62, Nxtra atpr 14. 1000 cells MEFs nextera tagmentation
  Index 62, NX adaptor 14. 6  ng purified DNA nextera tagmentation
  Index 63, N2 adaptor  15. 1000 cells lysed without transposome complex IVT
  Index 63, NX adaptor  15. 3  ng purified DNA nextera tagmentation
  Index 64, N2 adaptor  16. pure DNA only (6 ng) IVT
Index 64, NX adaptor  16. 600  pg purified DNA nextera tagmentation
  Index 65, N2 adaptor  17. Nuclease free H20 only IVT
Index 65, N2 adaptor  17. 1000 cells lysed without transposome complex IVT
  Index 66, Nxtra atpr 18. 1000 cells lysed without transposome complex nextera tagmentation
  Index 66, N2 adaptor  18. pure DNA only (6 ng) IVT
  Index 67, Nxtra atpr 19. pure DNA only (6 ng) nextera tagmentation
  Index 67, N2 adaptor  19. Nuclease free H20 only IVT
  Index 68, Nxtra atpr 20. Nuclease free H20 only nextera tagmentation
  Index 68, NX adaptor 20. 1000 cells lysed without transposome complex nextera tagmentation
  Index 69, NX adaptor 21. pure DNA only (6 ng) nextera tagmentation
  Index 70, NX adaptor 22. Nuclease free H20 only nextera tagmentation





Revision as of 01:20, 26 October 2012

Custom transposon with IVT amplification, round 3

  • will repeat IVT assay on 1000, 500, 100 cells, and nextera transposition on 500K, 100K, 10K, 1K, 500, and 100 cells.


  • got positive results from round 2, showing IVT to be more efficient and better data for calling peaks can see here. Data from nextera seems to be dependent on the number of reads, regardless of cellular concentration, not sure why.



  • to further show abilities and limitations of Nextera method, 10K, 50K and 150K cells will be used with nextera tagmentation protocol. Increased amounts of nextera transposomes will be used with each cellular amount since it has been observed lower cellular concentrations have better nextera transposome integration with higher transposomes/cells ratio.



  • Improvements from last assay
    • GM12878 DNA will be purified from GM12878 using RNase A (or Rnase mixture) and Protease AND proteinase K. Highly accessible regions are still highly accessible in pure DNA samples, want want to ensure proteins are not bound and RNA is not interfering. If those regions are still accessible then dunno why..


Why using RNAase III for fragmentation

  • Rnase III creates 5'-PO4 and 3'-OH termini on the fragments
  • however, Cuts ONLY dsRNA (used DNA blocking primer to block that)
  • Preferentially cuts from 5’ and 3’ ends (used blocking primer)
  • Rnase III results in 2 base 3’ overhangs
  • Used in the generation of siRNAs for knockdown
  • Mg++ fragmentation creates 5' OH and 3' PO4 termini, thus have to do end repair.
    • End Repair with Shrink Akaline phosphatase, PNK, Antarctic phosphatase
  • random nonamer is less selective and can prime off of more sequences


buffers compositions

1X T7 buffer:
400 mM Tris Hcl
8  mM MgCl2
2  mM spermidine-Hcl
25 mM NaCl
PH 7.9

1X NEBNext RNase III Reaction Buffer: 
10 mM Tris-HCl 
10 mM Mg(Cl)2 
1 mM DTT 
60 mM NaCl 
pH 8.3 @ 25°C

10X Poly(A) Polymerase buffer:
500 mM Tris-HCl
2.5 M NaCl
100 mM MgCl2
pH 7.9 @ 25°C

MMLV
Invitrogen (though using clontech)
5X First-Strand Buffer
250 mM Tris-HCl (pH 8.3 at room temperature
375 mM KCl
15 mM MgCl2
0.1 M DTT



Before starting protocols

1. Check if have enough reagents etc for the protocol

  • lysis buffer
  • nextera transposomes
  • transposase/transposome
  • IVT reaction mixture
  • cells etc
  • blocking primer, RNase III, PolyA Polymerase, ATP, taq polymerase, other primers


2. Purify GM12878 DNA from GM12878 cells with DNeasy blood and tissue kit for cells (USE PROTEINASE K (invitrogen) AND protease (qiagen) AND RNAase A). quanititate DNA with nanodrop.


3. samples

Samples:
1.  1000 cells IVT
2.  500  cells IVT
3.  100  cells IVT
4.  6   ng purified DNA IVT
5.  3   ng purified DNA IVT
6.  600 pg purified DNA IVT
7.  150K cells nextera tagmentation
8.  50K cells nextera tagmentation
9.  10K  cells nextera tagmentation
10. 1000 cells nextera tagmentation
11. 500  cells nextera tagmentation
12. 100  cells nextera tagmentation
13. 60  ng purified DNA nextera tagmentation
14. 6   ng purified DNA nextera tagmentation
15. 3   ng purified DNA nextera tagmentation
16. 600  pg purified DNA nextera tagmentation
17. 1000 cells lysed without transposome complex IVT
18. pure DNA only (6 ng) IVT
19. Nuclease free H20 only IVT
20. 1000 cells lysed without transposome complex nextera tagmentation
21. pure DNA only (6 ng) nextera tagmentation
22. Nuclease free H20 only nextera tagmentation

Nextera Tagmentation Protocol

1. See step 3 in IVT protocol. Do the cell lysis section for the "nextera tagmentation samples", samples 7-12,20,22.


2. Perform tagmentation on lysed cells and pure DNA. with 1:10 diluted nextera enzyme. (1:50 diluted in reaction). adjust amount of transposome on cell number

cells ng DNA nxta enzme to use
150,000 180 3 uL not diluted
50,000 120 2 uL not diluted
10,000 60 1 uL not diluted
1,000 6 3 uL 1/5 dltd enz
500 3 2 uL 1/5 dltd enz
100 0.6 1 uL, 1/10 dltd enz
60 ng pure 60 1 uL not diluted
6 ng pure 6 1 uL, 1/10 dltd enz
3 ng pure 3 1 uL, 1/10 dltd enz
600 pg pure 0.6 1 uL, 1/10 dltd enz
Dilute nextera enzyme as specified above.     
For each rxn, used mix of: 
 1ul 5x LMW Buffer
 2ul cell lysate
 Xul diluted enzyme
 Xul H2O
----------------------------
5ul total / reaction
55C 10 min


3. Protease (Qiagen) digestion of transposition reactions.

To each tube, add:
1 uL  Qiagen Protease, for 5 uL reaction 1 uL of .5 for .1 AU final. (stock is 5 AU and diluted 10X. want .5 AU/uL final [])
Incubate: 50C 10 minutes, 70C 20 minutes


4. First step of 2-step PCR thermocycling, terminate curves before saturation.

6   ul Tagmentation reaction
25  ul KAPA SYBR FAST qPCR mix
1   ul Orange Primer (10uM)
1   ul Blue Primer (10uM)
0.5 ul Bst Pol (5U/ul)
16.5 ul H2O 
----------------
50 uL total

Orange primer    CCTTGCCAGCCCGCTCAG   18nt
Blue primer      CCTCCCTCGCGCCATCAG   18nt 

PCR cycling. 72C for 3 minutes is for gap fill in.

72C 3min -> 95C 30 sec -> (95C 10sec -> 58C 30 sec -> 72 3min) x 25 -> 72C 3min.
Monitor the reactions on a real-time thermal cycler and terminate them before the curves reach saturation.


5. Begin 2-Step AMPure beads purification to remove primers, add index primers, for low input. (with forward read primer and reverse index primers)

a. see 2-step AMpure beads protocol, start from beginning for first purification

b. After cleaning, second PCR reaction to add index primers 

Barcodes to use:
Index 55, NX adaptor  7.  150K cells nextera tagmentation
Index 56, NX adaptor  8.  50K cells nextera tagmentation
Index 57, NX adaptor  9.  10K  cells nextera tagmentation
Index 58, NX adaptor  10. 1000 cells nextera tagmentation
Index 59, NX adaptor  11. 500  cells nextera tagmentation
Index 60, NX adaptor  12. 100  cells nextera tagmentation
Index 61, NX adaptor  13. 60  ng purified DNA nextera tagmentation
Index 62, NX adaptor  14. 6   ng purified DNA nextera tagmentation
Index 63, NX adaptor  15. 3   ng purified DNA nextera tagmentation
Index 64, NX adaptor  16. 600  pg purified DNA nextera tagmentation

Index 68, NX adaptor  20. 1000 cells lysed without transposome complex nextera tagmentation
Index 69, NX adaptor  21. pure DNA only (6 ng) nextera tagmentation
Index 70, NX adaptor  22. Nuclease free H20 only nextera tagmentation
add the following to above dry tube:
25 uL KAPA HF mix (used KAPA SYBR FAST qPCR mix instead)
1  uL adaptor1
1  uL of adaptor2 (barcode)
23 uL nuclease free H2O

c. PCR cycling for addition of index primer
5 cycles
72C 3min -> 95C 30 sec -> (95C 10sec -> 60C 30 sec -> 72 1 min) x 5 -> 72C 3min.

d. second phase of AMpure beads 2-step beads purification.

  • can run on gel and check smears to see for library.
  • should be ready for sequencing now?



IVT Protocol

  • If need to make more transposome, do first 2 steps.

1. annealing of ME sequence to T7 transposon sequence

    • a. Make 100 uM stock solution of T7tspn-top2 and T7tspn-bot.
    • b. Incubate 5 uL of each oligo (100uM) with 40 uL EB buffer at 95C for 2 minutes. Oligo's now at 10 uM in 50 uL.
    • c. cool to RT at 0.1 C/s


2. transposome complex generation, run controls!!!

  • add the below components into one tube and incubate for 20 minutes at RT
1.25 uL of annealed transposon
1.25 uL of 100% sterile glycerol
2.50 uL of Ez-TN5 transposase
  • store at -20, is good for a year


3. Prepare samples, lyse cells with lysis buffer

use pure GM12878 DNA

Samples:
1.  1000 cells IVT
2.  500  cells IVT
3.  100  cells IVT
4.  6   ng purified DNA IVT
5.  3   ng purified DNA IVT
6.  600 pg purified DNA IVT
17. 1000 cells lysed without transposome complex IVT
18. pure DNA only (6 ng) IVT
19. Nuclease free H20 only IVT


  • Make 10ml 10X lysis buffer (LB, 100mM Tris.Hcl pH 7.5, 100mM NaCl, 30mM MgCl2, 1% NP40, Crawford et al. PNAS 2003) in nuclease free H2O.
  • Prepare aliquots of lymphocytes GM12878 (have GM20431, GM12878, MEFs) that contain 1000, 500, 100 cells.
    • spin down cells to concentrate them as necessary.
  • Prepare 2X LB from 10X buffer. mineral oil optional.
  • if needed make 4 or 6 uL solutions. keep 1:1 ratio of cells:lysis buffer


  • make each cellular concentration in triplicate for AluI amplification with PCR for cell number quantification! store samples and perform quantification later. Use pure DNA nanodropped controls!!
AluI PCR quant
5 uL AluI 245-263 primer
5 uL AluI 21-40 primer
X sample 
X water
_________
50 uL
  • incubate below mixtures at 37C for 30 mins.
' 1. 1K IVT 2. 500 IVT 3. 100 IVT 7. 150K nxta 8. 50K nxta 9. 10K nxta 10. 1K nxta 11. 500 nxta 12. 100 nxta 17. 1K IVT con 19. NTC IVT 20. 1K nxta con 22. NTC nxta
cells 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul PBS 1 ul 1 ul PBS
2X LB 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul 1 ul


4. transposition reaction, using (T7tspn-top2)

  • add the below into one tube and incubate for 10 minutes at 55C.
1 uL nextera LMW buffer
2 uL lysed/pure genomic DNA (X ng/pg DNA)
1.2 uL Nuclease free water
.8 uL prepared T7 transposomes (MAKE SURE TO ADD LAST) (if was proportional to shendure would use .625 uL)
___________
5 uL total solution
method used in shendure paper:
4 uL nextera HMW buffer
X uL genomic DNA at prepared quantities
X uL Nuclease free water
______
17.5 uL total solution

add 2.5 uL of prepared transposomes


5. Protease digestion of transposase, protease inactivation

To each tube, add:
1 uL  Qiagen Protease, for 5 uL reaction 1 uL of .5 for .1 AU final. (stock is 5 AU and diluted 10X. want .5 AU/uL final [])
Incubate: 50C 10 minutes, 70C 20 minutes


6. Fill in reaction

  • Add 6 uL 2X taq polymerase, run at 72C for 3 minutes. (same as nextera)


7. Maxiscript (Ambion) T7 Protocol, IVT

  • DNA from PCR can be used directly in the MAXIscript Kit without any pretreatment or purification.
a. Thaw 10X Transcription Buffer and ribonucleotide solutions. Store the ribonucleotides (A, C, G, U) 
   on ice, but keep 10X transcription buffer at room temp

b. Assemble reaction mixture at room temperature, ADD IN ORDER AND MIX THOROUGHLY!!!!
  bring to 20 uL with Nuclease free water
  X   uL   DNA template (list 1 ug)
  2   uL   10X Transcription Buffer
  1   uL   10 mM ATP
  1   uL   10 mM CTP
  1   uL   10 mM GTP
  1   uL   10 mM UTP
  2   uL   T7 Enzyme Mix


b. Incubate reactions at 37C overnight for ~16 hours. (>10 uM limiting nucleotide)



8. Clean RNA with with Zymo RNA Clean & Concentrator-5 Kit

  • can quantitate with Qubit if needed, and run TBU-gel


9. Perform RNase III fragmentation (NEB):

Starting Material: Purified mRNA (50–250 nanograms)

 1. Add 5' end blocking DNA primer and do annealing to form DNA-RNA hybrid.
 *a. add 2 uL of blocking oligo (10 uM) to aliquot RNA sample that will be used in step 2.
     use T7-frag-block-top2 for T7-top2.  T7-frag-block for T7-top3
 *b. Incubate at 95C for 2 minutes.
 *c. cool to RT at 0.1 C/s


2. Mix the following components in a sterile PCR tube:

 X  uL Purified mRNA + blocking primer (50-250 nanograms)
 .5  uL RNase III (1 unit/μl)
 1   uL RNase III Reaction Buffer (10X)
 5.5 uL Nuclease-Free Water
 add in DNA primer to protect 5' end since don't want degradation??
 _______
 10 uL total volume


3. Incubate in a preheated thermal cycler for 5 minutes at 37°C.

4. Transfer tube to ice.


10. Zymo RNA clean and concentrator cleanup.

  • Resuspend in appropriate volume in nuclease free H2O (12 uL last time)
  • not doing protease digestion after RNA fragmentation since seems it wasn't as effective in previous RNase III fragmentation


11. Poly(A) Addition with polyA polymerase (Enzymatics)

  • enzymatics PolyA polymerase.
a. assemble reaction:
   2 uL 5X SMART MMLV first strand buffer (rather than 10X polyA buffer)
   1 uL polyA enzyme
   1 uL 10 mM ATP
   bring to 10 uL with RNA or w/e

b. Incubate at 37C for 10 minutes

c. Heat inactivate at 70C for 20 minutes. (rui and NEB)



12. single strand synthesis MMLV RT (Clontech)

20 uL reaction

1. Add 2.5 uL 20 uM primer stock to RNA sample. Bring to final volume of 12.5 uL with
   Nuclease free H2O (one from BENG160 class, T20VN_PE_R)

2. heat the mixture to 70C fo 3 minutes.  Immediately cool on ice.

3. Add the following to the reaction.
   2  uL 5X first strand buffer
   2  uL dNTP mix
   2  uL 100 uM DTT
   1  uL N-H20
  .5 uL SMART MMLV RT and mix (ADD LAST!!!!!)
  ____
   20 uL total

4. Incuvate at 42C for 60 minutes

5. Terminate the reaction by heating at 70C for 10 minutes



13. second strand synthesis (qPCR) (KAPA), addition of barcodes

Samples:
Index 49, N2 adaptor  1.  1000 cells IVT
Index 50, N2 adaptor  2.  500  cells IVT
Index 51, N2 adaptor  3.  100  cells IVT
Index 52, N2 adaptor  4.  6   ng purified DNA IVT
Index 53, N2 adaptor  5.  3   ng purified DNA IVT
Index 54, N2 adaptor  6.  600 pg purified DNA IVT

Index 65, N2 adaptor  17. 1000 cells lysed without transposome complex IVT
Index 66, N2 adaptor  18. pure DNA only (6 ng) IVT
Index 67, N2 adaptor  19. Nuclease free H20 only IVT


KAPA SYBR FAST qPCR mix until saturation, X35 cycles

25 uL KAPA SYBR FAST qPCR mix
4    uL primers, 2 uL F, 2 uL R (T7-top2-PCR-iaf or T7-top3-PCR-iaf) and (PCR_R.N2Ind[XX])
1  uL H2O
20    uL DNA template (use whole RT reaction)

KAPA SYBR cycles:
98C 3min, (98C for 30s, 60C for 30s, 72C for 2 min) X35, 72C for 5 min, 4C forever

  • terminate before curves saturate (usually cycle 6-7)


14.qiaquick cleanup

  • can quanitate with nanodrop


15. Gel Size selection

  • gel size select from 400-800 bp, follow gel size selection protocol
  • do not need to include controls.


16. Cloning and Transformation, then genewiz sequencing for verification of inserts


17. Submit for sequencing if genewiz sequencing checks out.

Results

Nextera results and gels

  • nanodrop results for nextera samples


  • ran gel after 2 step AMPure beads purification (addition of illuminia primers, barcodes)


  • qPCR curves for blue/orange amplification of products


IVT amplification results/gels

  • Used 1 uL for TBU gel, 2 uL for Qubit quantitation of RNA


  • graph of ng RNA versus cell number for IVT RNA amplification. Linear based on cell number.


  • RNA after IVT amplification, TBU gel


  • qPCR curves for barcode/adaptor addition
  • Negative controls amplified thus wierd, but looks fine when running TBE gel.



  • After barcode/illuminia adaptor addition. TBE gel, 50 uL sample total
fragments above 127 bp will have an insert, at least 157  for good insert

5’ end
GGGAGATCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG

3’ end T20VN_PE_R
AAAAAAAAAAAAAAAAAAAAACTAGCCTTCTCGCCAAGTCGTCCTTACG

3’ end of PCR_R.N2Ind[XX] with ILA adaptor
GCTCGAACATTAGAGCATACGGCAGAAGACGAAC



gel size selection

  • after gel size selection for IVT samples and for nextera samples
  • quanitated DNA in smears on gels from above and combined IVT samples, and nextera samples separately since are barcoded already.
  • used same amount of DNA per sample except samples that did not have enough.
  • IVT samples



  • nextera samples
  • gel size selection gel check



cloning and transformation with gel size selected sample



Notes ETC

  • since previous frag block was designed for T7-top3.
T7-frag-block-top2
5'- CTGTCTCTTATACACATCTCTGATGGCGCGAGGGAGGATCTCCC/3InvdT/  Tm= 81.45



Barcodes used:

Samples:
Index 49, N2 adaptor  1.  1000 cells IVT
Index 50, N2 adaptor  2.  500  cells IVT
Index 51, N2 adaptor  3.  100  cells IVT
Index 52, N2 adaptor  4.  6   ng purified DNA IVT
Index 53, N2 adaptor  5.  3   ng purified DNA IVT
Index 54, N2 adaptor  6.  600 pg purified DNA IVT
Index 55, NX adaptor  7.  150K cells nextera tagmentation
Index 56, NX adaptor  8.  50K cells nextera tagmentation
Index 57, NX adaptor  9.  10K  cells nextera tagmentation
Index 58, NX adaptor  10. 1000 cells nextera tagmentation
Index 59, NX adaptor  11. 500  cells nextera tagmentation
Index 60, NX adaptor  12. 100  cells nextera tagmentation
Index 61, NX adaptor  13. 60  ng purified DNA nextera tagmentation
Index 62, NX adaptor  14. 6   ng purified DNA nextera tagmentation
Index 63, NX adaptor  15. 3   ng purified DNA nextera tagmentation
Index 64, NX adaptor  16. 600  pg purified DNA nextera tagmentation
Index 65, N2 adaptor  17. 1000 cells lysed without transposome complex IVT
Index 66, N2 adaptor  18. pure DNA only (6 ng) IVT
Index 67, N2 adaptor  19. Nuclease free H20 only IVT
Index 68, NX adaptor  20. 1000 cells lysed without transposome complex nextera tagmentation
Index 69, NX adaptor  21. pure DNA only (6 ng) nextera tagmentation
Index 70, NX adaptor  22. Nuclease free H20 only nextera tagmentation


  • N2 adaptor with illuminia adatpor on the 5' end.
My modifications for T7-tspns for 5' addition primers
To use with (T7-top and T7-top2) transposons

5’- [AATGATACGGCGACCACCGA][GATCT][CTCCCTCGCGCCATCAGAGAT]  -3’  (Tm=86.59)
     ILA adaptor blue           Top2-5’end (T7-top2-PCR-iaf) Tm=66.79
                               (can be used if top1 is used for transposition)
  • N2 adaptors with barcodes and illuminia adaptors (N9_PE_R and T20VN_PE_R)
Barcode ID Barcode Primer Primer Name
Ind49 ACACAG CAAGCAGAAGACGGCATACGAGATACACAGCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind49
Ind50 AAAGGT CAAGCAGAAGACGGCATACGAGATAAAGGTCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind50
Ind51 GCGATA CAAGCAGAAGACGGCATACGAGATGCGATACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind51
Ind52 CGTGTC CAAGCAGAAGACGGCATACGAGATCGTGTCCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind52
Ind53 GTAGAA CAAGCAGAAGACGGCATACGAGATGTAGAACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind53
Ind54 GGACGT CAAGCAGAAGACGGCATACGAGATGGACGTCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind54
Ind55 AGTCGA CAAGCAGAAGACGGCATACGAGATAGTCGACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind55
Ind56 GTCTGA CAAGCAGAAGACGGCATACGAGATGTCTGACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind56
Ind57 GAAGGA CAAGCAGAAGACGGCATACGAGATGAAGGACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind57
Ind58 ATGCTG CAAGCAGAAGACGGCATACGAGATATGCTGCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind58
Ind59 TCTATC CAAGCAGAAGACGGCATACGAGATTCTATCCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind59
Ind60 ATCTGT CAAGCAGAAGACGGCATACGAGATATCTGTCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind60
Ind61 ATAGAG CAAGCAGAAGACGGCATACGAGATATAGAGCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind61
Ind62 GCTAAA CAAGCAGAAGACGGCATACGAGATGCTAAACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind62
Ind63 ACCAGG CAAGCAGAAGACGGCATACGAGATACCAGGCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind63
Ind64 CCAACT CAAGCAGAAGACGGCATACGAGATCCAACTCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind64
Ind65 AAGGAA CAAGCAGAAGACGGCATACGAGATAAGGAACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind65
Ind66 CCTCCA CAAGCAGAAGACGGCATACGAGATCCTCCACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind66
Ind67 CACGTC CAAGCAGAAGACGGCATACGAGATCACGTCCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind67
Ind68 CATAAC CAAGCAGAAGACGGCATACGAGATCATAACCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind68
Ind69 CCATAT CAAGCAGAAGACGGCATACGAGATCCATATCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind69
Ind70 GAAGTC CAAGCAGAAGACGGCATACGAGATGAAGTCCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind70
Ind71 CAAAGA CAAGCAGAAGACGGCATACGAGATCAAAGACTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind71
Ind72 TGGCAG CAAGCAGAAGACGGCATACGAGATTGGCAGCTCGGCATTCCTGCTGAACCGCTCTT PCR_R.N2Ind72



  • nextera Adaptor 1, matches blue primer, CCTCCCTCGCGCCATCAG, 18nt
Adaptor 1*: 5′-AATGATACGGCGACCACCGAGATCTACACGCCTCCCTCGCGCCATCAG-3′


  • nextera barcoded adaptor 2's and illuminia adaptors. matches orange primer, Orange primer CCTTGCCAGCCCGCTCAG, 18nt
Barcode ID Barcode Primer
Ind49 ACACAG CAAGCAGAAGACGGCATACGAGATACACAGCGGTCTGCCTTGCCAGCCCGCTCAG
Ind50 AAAGGT CAAGCAGAAGACGGCATACGAGATAAAGGTCGGTCTGCCTTGCCAGCCCGCTCAG
Ind51 GCGATA CAAGCAGAAGACGGCATACGAGATGCGATACGGTCTGCCTTGCCAGCCCGCTCAG
Ind52 CGTGTC CAAGCAGAAGACGGCATACGAGATCGTGTCCGGTCTGCCTTGCCAGCCCGCTCAG
Ind53 GTAGAA CAAGCAGAAGACGGCATACGAGATGTAGAACGGTCTGCCTTGCCAGCCCGCTCAG
Ind54 GGACGT CAAGCAGAAGACGGCATACGAGATGGACGTCGGTCTGCCTTGCCAGCCCGCTCAG
Ind55 AGTCGA CAAGCAGAAGACGGCATACGAGATAGTCGACGGTCTGCCTTGCCAGCCCGCTCAG
Ind56 GTCTGA CAAGCAGAAGACGGCATACGAGATGTCTGACGGTCTGCCTTGCCAGCCCGCTCAG
Ind57 GAAGGA CAAGCAGAAGACGGCATACGAGATGAAGGACGGTCTGCCTTGCCAGCCCGCTCAG
Ind58 ATGCTG CAAGCAGAAGACGGCATACGAGATATGCTGCGGTCTGCCTTGCCAGCCCGCTCAG
Ind59 TCTATC CAAGCAGAAGACGGCATACGAGATTCTATCCGGTCTGCCTTGCCAGCCCGCTCAG
Ind60 ATCTGT CAAGCAGAAGACGGCATACGAGATATCTGTCGGTCTGCCTTGCCAGCCCGCTCAG
Ind61 ATAGAG CAAGCAGAAGACGGCATACGAGATATAGAGCGGTCTGCCTTGCCAGCCCGCTCAG
Ind62 GCTAAA CAAGCAGAAGACGGCATACGAGATGCTAAACGGTCTGCCTTGCCAGCCCGCTCAG
Ind63 ACCAGG CAAGCAGAAGACGGCATACGAGATACCAGGCGGTCTGCCTTGCCAGCCCGCTCAG
Ind64 CCAACT CAAGCAGAAGACGGCATACGAGATCCAACTCGGTCTGCCTTGCCAGCCCGCTCAG
Ind65 AAGGAA CAAGCAGAAGACGGCATACGAGATAAGGAACGGTCTGCCTTGCCAGCCCGCTCAG
Ind66 CCTCCA CAAGCAGAAGACGGCATACGAGATCCTCCACGGTCTGCCTTGCCAGCCCGCTCAG
Ind67 CACGTC CAAGCAGAAGACGGCATACGAGATCACGTCCGGTCTGCCTTGCCAGCCCGCTCAG
Ind68 CATAAC CAAGCAGAAGACGGCATACGAGATCATAACCGGTCTGCCTTGCCAGCCCGCTCAG
Ind69 CCATAT CAAGCAGAAGACGGCATACGAGATCCATATCGGTCTGCCTTGCCAGCCCGCTCAG
Ind70 GAAGTC CAAGCAGAAGACGGCATACGAGATGAAGTCCGGTCTGCCTTGCCAGCCCGCTCAG
Ind71 CAAAGA CAAGCAGAAGACGGCATACGAGATCAAAGACGGTCTGCCTTGCCAGCCCGCTCAG
Ind72 TGGCAG CAAGCAGAAGACGGCATACGAGATTGGCAGCGGTCTGCCTTGCCAGCCCGCTCAG



Read primers used for sequencing:

T7tspn-Read1 and Nextera Read 1 primer are exactly the same except for first nucleotide on 5' end.

for IVT generated samples:
T7tspn-Read1 5'- TCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG -3'

N2RevSeq2 (read primer 2) 5'- CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT -3'

N2IndSeq 5'- AAGAGCGGTTCAGCAGGAATGCCGAG -3'


for Nextera generated samples:
Nextera Read 1 Primer: 5′- GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG -3′

Nextera Read 2 primer: 5′- GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG -3′

Nextera Index Read Primer: 5′-CTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGCAGACCG-3′

Stuff used for RNA-seq for BENG160 class

5’ end addition primers

TSO_N10_BC[XX]
[AAGCAGTGGTATCAACGCAGAGdUdU]NNNNNNNNNNTTTAGGrGrGrG
         adatpor1

5'- AAG CAG TGG TAT CAA CGC AGA G/ideoxyU//ideoxyU/ NNN NNN NNN NTT TAG GrGrGrG -3'

P1-STRT
5’- [AATGATACGGCGACCACCGA][GATCT][AAGCAGTGGTATCAACGCAGAGT] -3’  (Tm=82.59)
      ILA adaptor blue Tm=64.31         adaptor1 Tm=61.02

STRT-SEQ
5'- [GATCT][AAGCAGTGGTATCAACGCAGAGTT] -3'
                adaptor1
3’ end addition primers

T20VN_PE_R
5'-Bio-[GCATTCCTGCTGAACCGCTCTT]CCGATCTTTTTTTTTTTTTTTTTTTTTVN  -3’  (Tm=78.92)
          adaptor2 Tm=65.68

PCR_R.N2Ind[XX] (XX= index number)
5’- [CAAGCAGAAGACGGCATACGAGAT][TACAAG]CTCG][GCATTCCTGCTGAACCGCTCTT] -3’ (Tm=87.12)
        ILA adaptor orange       bc          adaptor2 Tm=65.68
My modifications for T7-tspns for 5' addition primers
 
To use with (T7-top and T7-top2) transposons

5’- [AATGATACGGCGACCACCGA][GATCT][CTCCCTCGCGCCATCAGAGAT]  -3’  (Tm=86.59)
     ILA adaptor blue           Top2-5’end (T7-top2-PCR-iaf) Tm=66.79
                               (can be used if top1 is used for transposition)


To use with (T7-top3) transposon

5’- [AATGATACGGCGACCACCGA][GATCT][GGGAGACATTAAGATGTGTATAAGAGACAG] -3’  (Tm=81.40)
     ILA adaptor blue              Top3-5’end (T7-top3-PCR-iaf) Tm=60.71