Arichard:Notebook/2013/June: Difference between revisions
>Andrew |
>Andrew |
||
(14 intermediate revisions by the same user not shown) | |||
Line 22: | Line 22: | ||
* I should probably wash the cells after thawing. | * I should probably wash the cells after thawing. | ||
===June 25, 2013=== | ===June 25, 2013=== | ||
Line 47: | Line 43: | ||
* Use UV treated 0.2 ml Axygen Cat# 22-154LR low retention tubes | * Use UV treated 0.2 ml Axygen Cat# 22-154LR low retention tubes | ||
---- | Sequences used in Quartz protocol: | ||
{| {{table}} | |||
| align="center" style="background:#f0f0f0;"|'''Name''' | |||
| align="center" style="background:#f0f0f0;"|'''Sequence''' | |||
|- | |||
| RT primer||TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT | |||
|- | |||
| Tagging primer||TATAGAATTCGCGGCCGCTCGCGATTTTTTTTTTTTTTTTTTTTTTTT | |||
|- | |||
| Suppression PCR primer||GTATAGAATTCGCGGCCGCTCGCGAT | |||
|- | |||
| | |||
|} | |||
* UHRR/ERCC mix: | * UHRR/ERCC mix: | ||
2.5 ul 500 pg/ul UHRR | |||
2.5 ul 1:1e4 ERCC | |||
14 ul H2O | |||
-------------- | |||
Total = 19 ul | |||
* RT annealing mix: | * RT annealing mix: | ||
3 ul 10X Titanium Taq buffer | |||
3 ul 1 mM dNTPs | |||
3 ul 0.833 uM RT primer | |||
2 ul RNasin Plus | |||
19 ul UHRR/ERCC mix | |||
---------------------------- | |||
Total = 30 ul | |||
* RT rxn mix: | * RT rxn mix: | ||
2 ul 10X Titanium Taq buffer | |||
13 ul H2O | |||
2.5 ul 0.1 M DTT | |||
2.5 ul SuperScript III | |||
----------------------------- | |||
Total = 20 ul | |||
* RT annealing rxn: | * RT annealing rxn: | ||
12 ul RT priming buffer (Quartz seq adds this to beads, but we are using purified reference RNA in the priming buffer) | |||
--------------------------------------------------------------------------------------------------- | |||
Total = 12 ul | |||
# 1 min @ RT | # 1 min @ RT | ||
# 90 sec @ 70 degC | # 90 sec @ 70 degC | ||
# 15 sec @ 35 degC | # 15 sec @ 35 degC | ||
# Hold @ 4 degC | # Hold @ 4 degC | ||
* RT rxn: | * RT rxn: | ||
12 ul RT annealing rxn | |||
8 ul RT rxn mix | |||
---------------------- | |||
Total = 20 ul | |||
# 5 min @ 35 degC | # 5 min @ 35 degC | ||
# 20 min @ 45 degC | # 20 min @ 45 degC | ||
Line 87: | Line 103: | ||
# Hold at 4 degC | # Hold at 4 degC | ||
# Prepare Exo I mix | # Prepare Exo I mix | ||
* Exo I mix: | * Exo I mix: | ||
2 ul 10X Titanium Taq buffer | |||
1 ul 10X Exo III buffer | |||
1 ul 0.1 M DTT | |||
3 ul Exo I | |||
23 ul H2O | |||
----------------------------- | |||
Total = 30 ul | |||
* RT primer removal: | * RT primer removal: | ||
** 20 ul RT rxn | ** 20 ul RT rxn | ||
** 36 ul Ampure RNAClean XP | ** 36 ul Ampure RNAClean XP | ||
* Total = 56 ul | ** Total = 56 ul | ||
# 10 min @ RT | # 10 min @ RT | ||
# 5 min on magnet | # 5 min on magnet | ||
Line 112: | Line 128: | ||
# 20 min @ 80 degC | # 20 min @ 80 degC | ||
# Hold @ 4 degC | # Hold @ 4 degC | ||
* PolyA mix: | * PolyA mix: | ||
1 ul 10X Titanium Taq buffer | |||
1.5 ul 20 mM dATP (dilute 100 mM dATP 1:5) | |||
1.2 ul 1:5 RNase H | |||
0.84 ul TdT (Roche) | |||
5.46 ul H2O | |||
------------------------------------------ | |||
Total = 10 ul | |||
* PolyA rxn: | * PolyA rxn: | ||
6 ul Exo I rxn | |||
5 ul PolyA mix | |||
-------------- | |||
Total = 11 ul | |||
# 50 sec @ 37 degC | # 50 sec @ 37 degC | ||
# 10 min @ 65 degC | # 10 min @ 65 degC | ||
# Hold @ 4 degC | # Hold @ 4 degC | ||
* 2nd strand mix: | * 2nd strand mix: | ||
78.25 ul 2x Terra buffer | |||
1 ul 10 uM Tagging primer | |||
6.25 ul Terra polymerase | |||
58.75 ul H2O | |||
------------------------- | |||
Total = 144.25 ul | |||
* 2nd strand rxn: | * 2nd strand rxn: | ||
11 ul PolyA rxn | |||
46 ul 2nd strand mix | |||
-------------------- | |||
Total = 57 ul | |||
# 10 sec @ 98 degC | # 10 sec @ 98 degC | ||
# 1 min @ 40 degC | # 1 min @ 40 degC | ||
Line 150: | Line 168: | ||
* PCR mix (Clontech): | * PCR mix (Clontech): | ||
21.1 ul 2x Terra | |||
1 ul 100 uM SuppressPCR primer | |||
25.25 ul H2O | |||
------------------------------ | |||
Total = 52.33 ul | |||
* PCR mix (KAPA): | * PCR mix (KAPA): | ||
21.1 ul 2x HiFi U+ | |||
1 ul 100 uM SuppressPCR primer | |||
25.25 ul H2O | |||
------------------------------ | |||
Total = 52.33 ul | |||
* PCR rxn: | * PCR rxn: | ||
57 ul 2nd strand rxn | |||
50 ul PCR mix | |||
--------------------- | |||
Total = 107 ul | |||
* Clontech protocol: | * Clontech protocol: | ||
Line 184: | Line 205: | ||
# Hold @ 4 degC | # Hold @ 4 degC | ||
---------------------------------- | ---------------------------------- | ||
* Store @ -80 degC until library prep | * Store @ -80 degC until library prep | ||
===June 26, 2013=== | ===June 26, 2013=== | ||
Line 190: | Line 211: | ||
* Library prep for Quartz-seq samples A1 and A2: | * Library prep for Quartz-seq samples A1 and A2: | ||
** Adapter ligation using KAPA Rapid Ligation, USER, and PCR with KAPA SYBR Fast (See Jeff and Noi's protocols). | ** Adapter ligation using KAPA Rapid Ligation, USER, and PCR with KAPA SYBR Fast (See Jeff and Noi's protocols). | ||
I used NEBNext Index Primers (the loop adapters). The following is directly from the NEBNext Multiplex Oligos for Illumina manual. | |||
{| {{table}} | |||
| align="center" style="background:#f0f0f0;"|'''Product''' | |||
| align="center" style="background:#f0f0f0;"|'''Index Primer Sequence''' | |||
| align="center" style="background:#f0f0f0;"|'''Expected Index Primer Sequence Read''' | |||
|- | |||
| NEBNext Index 11 Primer for Illumina||5´-CAAGCAGAAGACGGCATACGAGAT[GTAGCC]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3´||GGCTAC | |||
|- | |||
| NEBNext Index 12 Primer for Illumina||5´-CAAGCAGAAGACGGCATACGAGAT[TACAAG]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3´||CTTGTA | |||
|- | |||
| | |||
|} | |||
I used Index 12 for sample A1 (Terra) and Index 11 for Sample A2 (KAPA HiFi Uracil+). | |||
====CORE fragmentation and library prep==== | ====CORE fragmentation and library prep==== | ||
Line 201: | Line 239: | ||
* UDG/Endo IV rxn | * UDG/Endo IV rxn | ||
14.2 ul template | |||
1 ul 1:121 UDG | |||
1 ul 1:121 Endo IV | |||
1.8 ul Exo- buffer | |||
------------------ | |||
Total = 18 ul | |||
# 2 hrs @ 37 degC | # 2 hrs @ 37 degC | ||
# 15 min @ 65 degC | # 15 min @ 65 degC | ||
Line 212: | Line 251: | ||
* Nick translation | * Nick translation | ||
18 ul UDG/Endo IV rxn | |||
1 ul 1:50 Exo- | |||
1 ul 1:25 1 mM dNTP (40 uM) | |||
--------------------------- | |||
Total = 20 ul | |||
# 1 hrs @ 37 degC | # 1 hrs @ 37 degC | ||
# 15 min @ 75 degC | # 15 min @ 75 degC | ||
Line 222: | Line 262: | ||
* Ligation rxn | * Ligation rxn | ||
20 ul nick translation rxn | |||
25 ul 2X KAPA ligation buffer | |||
1.67 ul 1.5 uM loop adapter | |||
1.33 ul H2O | |||
KAPA DNA ligase | |||
----------------------------- | |||
Total = 50 ul | |||
# 15 min @ 20 degC | # 15 min @ 20 degC | ||
# Add 2 ul USER | # Add 2 ul USER | ||
Line 239: | Line 280: | ||
* PCR | * PCR | ||
20 ul template | |||
1 ul 10 uM PCR_F | |||
1 ul 10 uM NEBNext index | |||
3 ul H2O | |||
2X KAPA SYBR mix | |||
------------------------ | |||
Total = 50 ul | |||
# 30 sec @ 98 degC | # 30 sec @ 98 degC | ||
# 15 cycles: | # 15 cycles: | ||
Line 255: | Line 297: | ||
[[File: 2013_06_26 quartz seq 500 pg uhrr.jpd|400px]] | [[File: 2013_06_26 quartz seq 500 pg uhrr.jpd|400px]] | ||
I size selected the KAPA library (Index 11) and gave it to Alan for sequencing ([[Arichard:Samples/Sequencing_samples|AR_QC_500pgUhrrKapa_Jun26]]). | |||
===June 27, 2013=== | ===June 27, 2013=== |
Latest revision as of 02:21, 14 January 2014
June 2013[edit]
June 2, 2013[edit]
File:2013 06 02 hela5before.tif Cell 5, HeLa, before expelling onto glass top tube cap
File:2013 06 02 hela5after.tif Cell 5, HeLa, after expelling. The cell here is in the lower left of center. The other two objects are appear small, irregular, and shriveled as the focal plane is moved through them. This is difficult to convey in a single image.
File:2013 06 02 hela6before.tif Cell 6, HeLa, before expelling
File:2013 06 02 hela6after.tif Cell 6, HeLa, after expelling. There legitimately appears to multiple cells in this droplet.
- These samples were diluted to ~10,000 cells/ml --> 10 cells/ul. More dilution might help avoid picking multiple cells, but other technical challenges remain.
- After depositing the cell on the glass top tube cap, there is only ~10 seconds before the droplet dries (~100 nl maximum volume by my estimate, although variance is large.) This is hardly enough time to image the cell.
- The CEL-Seq paper refers to "pipetting off excess liquid." I haven't tried this yet. I could deposit the cell in a larger volume, and then adjust the volume down. This issue here would be finding the cell in that larger volume (if I fail to see it shoot out of the pipette.) Also, the omnipresent dust particle and cell debris make imaging the cells very hard in BF.
- I should probably wash the cells after thawing.
June 25, 2013[edit]
- Implemented Quartz seq, Samples A1 and A2.
- Original Quartz-seq protocols:
http://bit.accc.riken.jp/protocols/
- Sample A1: 500 pg UHRR, CEL-Seq equivalent ERCC, Quartz purified RNA protocol. Used 2x Terra Direct PCR Mix.
- Sample A2: Same, except I used 2x KAPA HiFi Uracil+.
- Both samples had 1 ul of 1:500 dilution of 100 mM dUTP during final PCR (107 ul total volume).
Quartz-Seq Protocol for 500 pg Agilent UHRR, 2 samples[edit]
- Work in the PCR hood
- Keep enzyme stocks in cold box
- Mix reactions on cold rack
- Use UV treated Ambion RNase/DNase free water
- Use UV treated 0.5 and 1.5 ml Eppendorf Lo-Bind tubes
- Use UV treated 0.2 ml Axygen Cat# 22-154LR low retention tubes
Sequences used in Quartz protocol:
Name | Sequence |
RT primer | TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT |
Tagging primer | TATAGAATTCGCGGCCGCTCGCGATTTTTTTTTTTTTTTTTTTTTTTT |
Suppression PCR primer | GTATAGAATTCGCGGCCGCTCGCGAT |
- UHRR/ERCC mix:
2.5 ul 500 pg/ul UHRR 2.5 ul 1:1e4 ERCC 14 ul H2O -------------- Total = 19 ul
- RT annealing mix:
3 ul 10X Titanium Taq buffer 3 ul 1 mM dNTPs 3 ul 0.833 uM RT primer 2 ul RNasin Plus 19 ul UHRR/ERCC mix ---------------------------- Total = 30 ul
- RT rxn mix:
2 ul 10X Titanium Taq buffer 13 ul H2O 2.5 ul 0.1 M DTT 2.5 ul SuperScript III ----------------------------- Total = 20 ul
- RT annealing rxn:
12 ul RT priming buffer (Quartz seq adds this to beads, but we are using purified reference RNA in the priming buffer) --------------------------------------------------------------------------------------------------- Total = 12 ul
- 1 min @ RT
- 90 sec @ 70 degC
- 15 sec @ 35 degC
- Hold @ 4 degC
- RT rxn:
12 ul RT annealing rxn 8 ul RT rxn mix ---------------------- Total = 20 ul
- 5 min @ 35 degC
- 20 min @ 45 degC
- 10 min @ 70 degC
- Hold at 4 degC
- Prepare Exo I mix
- Exo I mix:
2 ul 10X Titanium Taq buffer 1 ul 10X Exo III buffer 1 ul 0.1 M DTT 3 ul Exo I 23 ul H2O ----------------------------- Total = 30 ul
- RT primer removal:
- 20 ul RT rxn
- 36 ul Ampure RNAClean XP
- Total = 56 ul
- 10 min @ RT
- 5 min on magnet
- Wash 2x with 1 min with 50 ul 80% EtOH
- Dry 3 min
- Add 6 ul Exo I mix
- 1 min @ RT
- 5 min on magnet
- Transfer to new tube
- 30 min @ 37 degC
- 20 min @ 80 degC
- Hold @ 4 degC
- PolyA mix:
1 ul 10X Titanium Taq buffer 1.5 ul 20 mM dATP (dilute 100 mM dATP 1:5) 1.2 ul 1:5 RNase H 0.84 ul TdT (Roche) 5.46 ul H2O ------------------------------------------ Total = 10 ul
- PolyA rxn:
6 ul Exo I rxn 5 ul PolyA mix -------------- Total = 11 ul
- 50 sec @ 37 degC
- 10 min @ 65 degC
- Hold @ 4 degC
- 2nd strand mix:
78.25 ul 2x Terra buffer 1 ul 10 uM Tagging primer 6.25 ul Terra polymerase 58.75 ul H2O ------------------------- Total = 144.25 ul
- 2nd strand rxn:
11 ul PolyA rxn 46 ul 2nd strand mix -------------------- Total = 57 ul
- 10 sec @ 98 degC
- 1 min @ 40 degC
- 5 min @ 68 degC
- Hold @ 4 degC
- Move to cold rack
- PCR mix (Clontech):
21.1 ul 2x Terra 1 ul 100 uM SuppressPCR primer 25.25 ul H2O ------------------------------ Total = 52.33 ul
- PCR mix (KAPA):
21.1 ul 2x HiFi U+ 1 ul 100 uM SuppressPCR primer 25.25 ul H2O ------------------------------ Total = 52.33 ul
- PCR rxn:
57 ul 2nd strand rxn 50 ul PCR mix --------------------- Total = 107 ul
- Clontech protocol:
- Preheat, 10 sec @ 68 deg
- 15 cycles:
- 10 sec @ 98 degC
- 15 sec @ 65 degC
- 5 min @ 68 degC
- 5 min @ 68 degC
- Hold @ 4 degC
- KAPA protocol
- 5 min @ 95 degC
- 15 cycles:
- 20 sec @ 98 degC
- 15 sec @ 65 degC
- 5 min @ 72 degC
- 5 min @ 72 degC
- Hold @ 4 degC
- Store @ -80 degC until library prep
June 26, 2013[edit]
- Library prep for Quartz-seq samples A1 and A2:
- Adapter ligation using KAPA Rapid Ligation, USER, and PCR with KAPA SYBR Fast (See Jeff and Noi's protocols).
I used NEBNext Index Primers (the loop adapters). The following is directly from the NEBNext Multiplex Oligos for Illumina manual.
Product | Index Primer Sequence | Expected Index Primer Sequence Read |
NEBNext Index 11 Primer for Illumina | 5´-CAAGCAGAAGACGGCATACGAGAT[GTAGCC]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3´ | GGCTAC |
NEBNext Index 12 Primer for Illumina | 5´-CAAGCAGAAGACGGCATACGAGAT[TACAAG]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3´ | CTTGTA |
I used Index 12 for sample A1 (Terra) and Index 11 for Sample A2 (KAPA HiFi Uracil+).
CORE fragmentation and library prep[edit]
- Work in PCR hood
- UV treat H2O, tips, tubes
- Purified Quartz WTA products using Ampure XP beads
- Added 100 ul beads to 107 ul product
- Eluted in 14.2 ul H2O
- UDG/Endo IV rxn
14.2 ul template 1 ul 1:121 UDG 1 ul 1:121 Endo IV 1.8 ul Exo- buffer ------------------ Total = 18 ul
- 2 hrs @ 37 degC
- 15 min @ 65 degC
- Hold @ 4 degc
- Nick translation
18 ul UDG/Endo IV rxn 1 ul 1:50 Exo- 1 ul 1:25 1 mM dNTP (40 uM) --------------------------- Total = 20 ul
- 1 hrs @ 37 degC
- 15 min @ 75 degC
- Hold @ 4 degC
- Ligation rxn
20 ul nick translation rxn 25 ul 2X KAPA ligation buffer 1.67 ul 1.5 uM loop adapter 1.33 ul H2O KAPA DNA ligase ----------------------------- Total = 50 ul
- 15 min @ 20 degC
- Add 2 ul USER
- 15 min @ 37 degC
- Hold @ 4 degC
- Ampure XP bead purification
- 50 ul beads
- Elute in 20 ul H2O
- PCR
20 ul template 1 ul 10 uM PCR_F 1 ul 10 uM NEBNext index 3 ul H2O 2X KAPA SYBR mix ------------------------ Total = 50 ul
- 30 sec @ 98 degC
- 15 cycles:
- 10 sec @ 98 degC
- 30 sec @ 65 degC
- 45 sec @ 72 degC
- 2 min @ 72 degC
- Hold @ 4 degC
File:2013 06 26 quartz seq 500 pg uhrr.jpd
I size selected the KAPA library (Index 11) and gave it to Alan for sequencing (AR_QC_500pgUhrrKapa_Jun26).