Matt:LabNotes/2013-7-1: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
(Created page with "====Amplification with Sequencing Adapters==== *Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007) **[[Media:probe2padlockFISSEQ_2...")
 
>Mzcai
mNo edit summary
Line 1: Line 1:
Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-6-28
====Amplification with Sequencing Adapters====
====Amplification with Sequencing Adapters====


Line 6: Line 8:


*Since this is the same design as LC Sciences probes that Noi used, I'll use the same [http://genome-tech.ucsd.edu/LabNotes/index.php/Illumina_GA/Oligo_info#Primers_for_LC_Sciences_library-free_protocol primers]
*Since this is the same design as LC Sciences probes that Noi used, I'll use the same [http://genome-tech.ucsd.edu/LabNotes/index.php/Illumina_GA/Oligo_info#Primers_for_LC_Sciences_library-free_protocol primers]
{| {{table}} border = 1
| align="center" style="background:#f0f0f0;"|'''Tube #'''
| align="center" style="background:#f0f0f0;"|'''Sample'''
| align="center" style="background:#f0f0f0;"|'''Index#'''
|-
| 1||NTC-0gap||Indx7
|-
| 2||gDNA-0gap||Indx45
|-
| 3||cDNA-0gap||Indx76
|-
| 4||NTC-20gap||Indx7
|-
| 5||gDNA-20gap||Indx77
|-
| 6||cDNA-20gap||Indx78
|-
|
|} <br>
{| {{table}} border = 1
| align="center" style="background:#f0f0f0;"|'''Components'''
| align="center" style="background:#f0f0f0;"|'''1rxn'''
| align="center" style="background:#f0f0f0;"|'''6.5 rxn'''
|-
| Captured template||12.00||0.00
|-
| 10uM Forward+Indx||2.00||0.00
|-
| 10uM Reverse||2.00||13.00
|-
| 2x KAPA SYBG fast MM||50.00||325.00
|-
| H2O||34.00||221.00
|-
| Total||100.00||650.00
|}


   Program
   Program
   *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold
   *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold

Revision as of 19:34, 1 July 2013

Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-6-28

Amplification with Sequencing Adapters

  • Since this is the same design as LC Sciences probes that Noi used, I'll use the same primers
Tube # Sample Index#
1 NTC-0gap Indx7
2 gDNA-0gap Indx45
3 cDNA-0gap Indx76
4 NTC-20gap Indx7
5 gDNA-20gap Indx77
6 cDNA-20gap Indx78


Components 1rxn 6.5 rxn
Captured template 12.00 0.00
10uM Forward+Indx 2.00 0.00
10uM Reverse 2.00 13.00
2x KAPA SYBG fast MM 50.00 325.00
H2O 34.00 221.00
Total 100.00 650.00
 Program
 *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold