Matt:LabNotes/2013-7-1: Difference between revisions
Jump to navigation
Jump to search
>Mzcai (Created page with "====Amplification with Sequencing Adapters==== *Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007) **[[Media:probe2padlockFISSEQ_2...") |
>Mzcai mNo edit summary |
||
Line 1: | Line 1: | ||
Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-6-28 | |||
====Amplification with Sequencing Adapters==== | ====Amplification with Sequencing Adapters==== | ||
Line 6: | Line 8: | ||
*Since this is the same design as LC Sciences probes that Noi used, I'll use the same [http://genome-tech.ucsd.edu/LabNotes/index.php/Illumina_GA/Oligo_info#Primers_for_LC_Sciences_library-free_protocol primers] | *Since this is the same design as LC Sciences probes that Noi used, I'll use the same [http://genome-tech.ucsd.edu/LabNotes/index.php/Illumina_GA/Oligo_info#Primers_for_LC_Sciences_library-free_protocol primers] | ||
{| {{table}} border = 1 | |||
| align="center" style="background:#f0f0f0;"|'''Tube #''' | |||
| align="center" style="background:#f0f0f0;"|'''Sample''' | |||
| align="center" style="background:#f0f0f0;"|'''Index#''' | |||
|- | |||
| 1||NTC-0gap||Indx7 | |||
|- | |||
| 2||gDNA-0gap||Indx45 | |||
|- | |||
| 3||cDNA-0gap||Indx76 | |||
|- | |||
| 4||NTC-20gap||Indx7 | |||
|- | |||
| 5||gDNA-20gap||Indx77 | |||
|- | |||
| 6||cDNA-20gap||Indx78 | |||
|- | |||
| | |||
|} <br> | |||
{| {{table}} border = 1 | |||
| align="center" style="background:#f0f0f0;"|'''Components''' | |||
| align="center" style="background:#f0f0f0;"|'''1rxn''' | |||
| align="center" style="background:#f0f0f0;"|'''6.5 rxn''' | |||
|- | |||
| Captured template||12.00||0.00 | |||
|- | |||
| 10uM Forward+Indx||2.00||0.00 | |||
|- | |||
| 10uM Reverse||2.00||13.00 | |||
|- | |||
| 2x KAPA SYBG fast MM||50.00||325.00 | |||
|- | |||
| H2O||34.00||221.00 | |||
|- | |||
| Total||100.00||650.00 | |||
|} | |||
Program | Program | ||
*98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold | *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold |
Revision as of 19:34, 1 July 2013
Continued from: http://genome-tech.ucsd.edu/LabNotes/index.php/Matt:LabNotes/2013-6-28
Amplification with Sequencing Adapters
- Common linker sequence in every probe is: CTTCAGCTTCCCGATATCCGACGGTAGTGT (Porecca et al. 2007)
- Since this is the same design as LC Sciences probes that Noi used, I'll use the same primers
Tube # | Sample | Index# |
1 | NTC-0gap | Indx7 |
2 | gDNA-0gap | Indx45 |
3 | cDNA-0gap | Indx76 |
4 | NTC-20gap | Indx7 |
5 | gDNA-20gap | Indx77 |
6 | cDNA-20gap | Indx78 |
Components | 1rxn | 6.5 rxn |
Captured template | 12.00 | 0.00 |
10uM Forward+Indx | 2.00 | 0.00 |
10uM Reverse | 2.00 | 13.00 |
2x KAPA SYBG fast MM | 50.00 | 325.00 |
H2O | 34.00 | 221.00 |
Total | 100.00 | 650.00 |
Program *98°C 30sec -> (98°C 10sec -> 52°C 30sec -> 72°C 30sec) x8 cycles -> (98°C 10sec -> 72°C 30sec) x7 cycles -> 72°C 3 min -> 15°C hold