Hosuk:LabNotes/2013-8-5: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Hosuki78
No edit summary
>Hosuki78
No edit summary
Line 36: Line 36:




*Start at 06/29
**Use cell dishes fixed at 07/07 --> Cells were not plenty… need to thaw new one
**GC, lysine coated dish
**Run RT : 5:00pm 07/07 ~ 9:00am 07/08 --> ~15hr.
**Run CircLigase II : S1 --> 1:30pm 07/08 ~ 3:30pm 07/08 --> 2hr.
**Run CircLigase II : S2 --> 11:30am 07/08 ~ 3:30pm 07/08 --> 4hr.
**Run RCA : 4:30 pm 07/08 ~ 12:30pm 07/09 --> ~20hr.


=====Rolony generation====
*Add template, incubate 15min
*Run RNase H +Riboshredder for 1hr at 60C.
*Run RCA for 20hr at 30C




====Result====
 
=====Run Cycle with 3 probes=====
*Procedure : Hybridize Probe1-Cy3 --> Image --> Strip --> Image --> Probe4-FAM --> Image --> Strip --> Image --> Probe2-Cy3 --> Image --> …
*Cy3 signal looked good, but FAM signal was weak, and fewer numbers.
*Second Cy3 probes were fewer than first one, it was because of less non-specific binding due to Formamide…??
*We'll try using confocal for FAM signal imaging, and try Matt's oligo one more time.
 
 
 
[[File:Probes_CycleRun.png|400px]]

Revision as of 00:28, 6 August 2013


Test Decoding probes using custom pre-circularized oligos

Previous try

  • Alan and I have tried decoding pre-circularized oligos made from Matt at 07/30/2013.
  • I added oligos in fixed cells on MatTek glass-bottom dish, and ran RCA to generate rolonies.
  • However the signal wasn’t seen any FL signal after hybridizing decoding probes.
  • We suspected that the amount of oligos might not enough (The actual concentration or amount of the oligos was unknown).
  • So I've ordered 90bp ssDNA from IDT which has 3 sites for decoding probes and 1 site for RCA probes.


2nd try with 90bp custom oligo

=Template design

  • Sequence : /5Phos/CCCGATATCCGACGGTAGTGTGTCTTGCGTGCGATACGGAGTATCTACTTCGTCGCGTCAGACCATCGGAATACGTCGTTGACTGCGTTC
  • RCA probe sequence : ACACTACCGTCGGATATC
  • Decoding probes for this experiment
    • dcProbe1-Cy3 : Cy3-GTCTTGCGTGCGATACGGAGTA
    • dcProbe2-Cy3 : Cy3-TCTACTTCGTCGCGTCAGACCA
    • dcProbe4-FAM : FAM-TCGGAATACGTCGTTGACTGCG

File:Sequence Template Probes.png


=Circularization

  • CircLigase II reaction with 50pmole input DNA
    • 6 hr reaction

File:CircLigaseII 20uL.png


  • Circ. reaction lane has no band near 90bp, it seemed circularized.

File:CircLigaseII 20uL Gel.png


=Rolony generation

  • Add template, incubate 15min
  • Run RNase H +Riboshredder for 1hr at 60C.
  • Run RCA for 20hr at 30C


Run Cycle with 3 probes
  • Procedure : Hybridize Probe1-Cy3 --> Image --> Strip --> Image --> Probe4-FAM --> Image --> Strip --> Image --> Probe2-Cy3 --> Image --> …
  • Cy3 signal looked good, but FAM signal was weak, and fewer numbers.
  • Second Cy3 probes were fewer than first one, it was because of less non-specific binding due to Formamide…??
  • We'll try using confocal for FAM signal imaging, and try Matt's oligo one more time.


File:Probes CycleRun.png