Hosuk:LabNotes/2013-8-5: Difference between revisions
Jump to navigation
Jump to search
>Hosuki78 |
>Hosuki78 No edit summary |
||
(6 intermediate revisions by the same user not shown) | |||
Line 13: | Line 13: | ||
====2nd try with 90bp custom oligo==== | ====2nd try with 90bp custom oligo==== | ||
=====Template design==== | =====Template design===== | ||
*Sequence : /5Phos/CCCGATATCCGACGGTAGTGTGTCTTGCGTGCGATACGGAGTATCTACTTCGTCGCGTCAGACCATCGGAATACGTCGTTGACTGCGTTC | *Sequence : /5Phos/CCCGATATCCGACGGTAGTGTGTCTTGCGTGCGATACGGAGTATCTACTTCGTCGCGTCAGACCATCGGAATACGTCGTTGACTGCGTTC | ||
*RCA probe sequence : ACACTACCGTCGGATATC | *RCA probe sequence : ACACTACCGTCGGATATC | ||
Line 20: | Line 20: | ||
**dcProbe2-Cy3 : Cy3-TCTACTTCGTCGCGTCAGACCA | **dcProbe2-Cy3 : Cy3-TCTACTTCGTCGCGTCAGACCA | ||
**dcProbe4-FAM : FAM-TCGGAATACGTCGTTGACTGCG | **dcProbe4-FAM : FAM-TCGGAATACGTCGTTGACTGCG | ||
[[File: | [[File:Sequence_Template_Probes_.png|500px]] | ||
=====Circularization==== | =====Circularization===== | ||
*CircLigase II reaction with 50pmole input DNA | *CircLigase II reaction with 50pmole input DNA | ||
**6 hr reaction | **6 hr reaction | ||
Line 37: | Line 37: | ||
=====Rolony generation==== | =====Rolony generation===== | ||
*Add template, incubate 15min | *Add template, incubate 15min | ||
*Run RNase H +Riboshredder for 1hr at 60C. | *Run RNase H +Riboshredder for 1hr at 60C. | ||
Line 52: | Line 52: | ||
[[File: | [[File:Probes_CycleRun12.png|800px]] | ||
[[File:Probes_CycleRun34.png|800px]] | |||
[[File:Probes_CycleRun567.png|800px]] | |||
*'''Overlay''' [[Media:Composite_Probe1-Cy3_Probe2-Cy3.jpg|Probe1-Cy3 and Probe2-Cy3]], [[Media:Composite_Probe2-Cy3_Probe4-FAM.jpg|Probe2-Cy3 and Probe4-FAM]] | |||
[[File:Probes_CycleRun_Composites.png|800px]] |
Latest revision as of 03:50, 6 August 2013
Test Decoding probes using custom pre-circularized oligos[edit]
Previous try[edit]
- Alan and I have tried decoding pre-circularized oligos made from Matt at 07/30/2013.
- I added oligos in fixed cells on MatTek glass-bottom dish, and ran RCA to generate rolonies.
- However the signal wasn’t seen any FL signal after hybridizing decoding probes.
- We suspected that the amount of oligos might not enough (The actual concentration or amount of the oligos was unknown).
- So I've ordered 90bp ssDNA from IDT which has 3 sites for decoding probes and 1 site for RCA probes.
2nd try with 90bp custom oligo[edit]
Template design[edit]
- Sequence : /5Phos/CCCGATATCCGACGGTAGTGTGTCTTGCGTGCGATACGGAGTATCTACTTCGTCGCGTCAGACCATCGGAATACGTCGTTGACTGCGTTC
- RCA probe sequence : ACACTACCGTCGGATATC
- Decoding probes for this experiment
- dcProbe1-Cy3 : Cy3-GTCTTGCGTGCGATACGGAGTA
- dcProbe2-Cy3 : Cy3-TCTACTTCGTCGCGTCAGACCA
- dcProbe4-FAM : FAM-TCGGAATACGTCGTTGACTGCG
File:Sequence Template Probes .png
Circularization[edit]
- CircLigase II reaction with 50pmole input DNA
- 6 hr reaction
- Circ. reaction lane has no band near 90bp, it seemed circularized.
File:CircLigaseII 20uL Gel.png
Rolony generation[edit]
- Add template, incubate 15min
- Run RNase H +Riboshredder for 1hr at 60C.
- Run RCA for 20hr at 30C
Run Cycle with 3 probes[edit]
- Procedure : Hybridize Probe1-Cy3 --> Image --> Strip --> Image --> Probe4-FAM --> Image --> Strip --> Image --> Probe2-Cy3 --> Image --> …
- Cy3 signal looked good, but FAM signal was weak, and fewer numbers.
- Second Cy3 probes were fewer than first one, it was because of less non-specific binding due to Formamide…??
- We'll try using confocal for FAM signal imaging, and try Matt's oligo one more time.