Hosuk:LabNotes/2013-8-5: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Hosuki78
No edit summary
>Hosuki78
No edit summary
 
(One intermediate revision by the same user not shown)
Line 20: Line 20:
**dcProbe2-Cy3 : Cy3-TCTACTTCGTCGCGTCAGACCA
**dcProbe2-Cy3 : Cy3-TCTACTTCGTCGCGTCAGACCA
**dcProbe4-FAM : FAM-TCGGAATACGTCGTTGACTGCG
**dcProbe4-FAM : FAM-TCGGAATACGTCGTTGACTGCG
[[File:Sequence_Template_Probes.png|500px]]
[[File:Sequence_Template_Probes_.png|500px]]




Line 63: Line 63:


*'''Overlay''' [[Media:Composite_Probe1-Cy3_Probe2-Cy3.jpg|Probe1-Cy3 and Probe2-Cy3]], [[Media:Composite_Probe2-Cy3_Probe4-FAM.jpg|Probe2-Cy3 and Probe4-FAM]]
*'''Overlay''' [[Media:Composite_Probe1-Cy3_Probe2-Cy3.jpg|Probe1-Cy3 and Probe2-Cy3]], [[Media:Composite_Probe2-Cy3_Probe4-FAM.jpg|Probe2-Cy3 and Probe4-FAM]]
[[File:Probes_CycleRun_Composites.png|1000px]]
[[File:Probes_CycleRun_Composites.png|800px]]

Latest revision as of 03:50, 6 August 2013


Test Decoding probes using custom pre-circularized oligos[edit]

Previous try[edit]

  • Alan and I have tried decoding pre-circularized oligos made from Matt at 07/30/2013.
  • I added oligos in fixed cells on MatTek glass-bottom dish, and ran RCA to generate rolonies.
  • However the signal wasn’t seen any FL signal after hybridizing decoding probes.
  • We suspected that the amount of oligos might not enough (The actual concentration or amount of the oligos was unknown).
  • So I've ordered 90bp ssDNA from IDT which has 3 sites for decoding probes and 1 site for RCA probes.


2nd try with 90bp custom oligo[edit]

Template design[edit]
  • Sequence : /5Phos/CCCGATATCCGACGGTAGTGTGTCTTGCGTGCGATACGGAGTATCTACTTCGTCGCGTCAGACCATCGGAATACGTCGTTGACTGCGTTC
  • RCA probe sequence : ACACTACCGTCGGATATC
  • Decoding probes for this experiment
    • dcProbe1-Cy3 : Cy3-GTCTTGCGTGCGATACGGAGTA
    • dcProbe2-Cy3 : Cy3-TCTACTTCGTCGCGTCAGACCA
    • dcProbe4-FAM : FAM-TCGGAATACGTCGTTGACTGCG

File:Sequence Template Probes .png


Circularization[edit]
  • CircLigase II reaction with 50pmole input DNA
    • 6 hr reaction

File:CircLigaseII 20uL.png


  • Circ. reaction lane has no band near 90bp, it seemed circularized.

File:CircLigaseII 20uL Gel.png


Rolony generation[edit]
  • Add template, incubate 15min
  • Run RNase H +Riboshredder for 1hr at 60C.
  • Run RCA for 20hr at 30C


Run Cycle with 3 probes[edit]
  • Procedure : Hybridize Probe1-Cy3 --> Image --> Strip --> Image --> Probe4-FAM --> Image --> Strip --> Image --> Probe2-Cy3 --> Image --> …
  • Cy3 signal looked good, but FAM signal was weak, and fewer numbers.
  • Second Cy3 probes were fewer than first one, it was because of less non-specific binding due to Formamide…??
  • We'll try using confocal for FAM signal imaging, and try Matt's oligo one more time.


File:Probes CycleRun12.png


File:Probes CycleRun34.png


File:Probes CycleRun567.png


File:Probes CycleRun Composites.png