Hosuk:LabNotes/2013-9-12: Difference between revisions
Jump to navigation
Jump to search
>Hosuki78 No edit summary |
>Hosuki78 No edit summary |
||
Line 52: | Line 52: | ||
* | *2nd Rolony generation at 09/10~09/11, imaging at 09/11 | ||
===Result=== | |||
*1st Padlock probes for ACTB were not seen well, too sparse and too few | |||
*2nd Padlock probes for RAB7A were many, more than ACTB. | |||
*Currently we don't know why there are not many signal on 2nd rolonies, becuase of... | |||
**Ampligase reaction were not good? or low efficiency? becuase of temperature in oven? incubation time? | |||
**Not enough padlock probes? or poor hybrizing efficiency? | |||
*need to figure out | |||
*We need to check all of 2nd rolonies, so we are going to use FITC-labeled probes which is the sequence for the region of 2nd RCA probes (488nm dye labeled CTTCAGCTTCCCGATATC) | |||
====figures==== |
Revision as of 18:11, 12 September 2013
Gene decoding with Barcoded Padlock probes
Experimental plan
- Hybridizing padlock probes on 1st rolonies, and
- Generate 2nd rolonies over 1st rolonies, and
- Observe each different fluorescent signal from 2nd rolonies
Procedure
- Prepare two barcoded padlock probes - ACTB, RAB7A
Padlock probe for ACTB
- ppACTB : /5Phos/CTGTGCTCGCGGGGCG CTTCAGCTTCCCGATATC CGACGG ACGTATCGGTAGTCGCAACGCA GGCAAAGGCGAGGCT --> 77bp
- two arms : CTGTGCTCGCGGGGCG, GGCAAAGGCGAGGCT
- site for decoding probes (dcProbe0-Cy3) : ACGTATCGGTAGTCGCAACGCA --> 22bp
- site for 2nd RCA probes : CTTCAGCTTCCCGATATC --> 18bp
Padlock probe for RAB7A
- ppRAB7A : /5Phos/GAAGCGAGAAGGTCCAAGTTCTG CTTCAGCTTCCCGATATC CGACGG GTCTTGCGTGCGATACGGAGTA GAGGAGACTAAACGGAGGACA --> 90bp
- two arms : GAAGCGAGAAGGTCCAAGTTCTG, GAGGAGACTAAACGGAGGACA
- site for decoding probes (dcProbe1-Cy3) : GTCTTGCGTGCGATACGGAGTA --> 22bp
- site for 2nd RCA probes : CTTCAGCTTCCCGATATC --> 18bp
2nd RCA probe
- FISSEQ_ppRCA : GATATCGGGAAGCTGA*A*G --> 18bp
Overall Process
- Prepare each probes – the concentration of each probes are resuspended to 200uM for each ACTB, RAB7A and 2nd RCA primer.
- Hybridize Padlock probe – mixture: 1uL ACTB + 1uL RAB7A + 98uL 2x SSC
- Add mix, and incubate dish in the oven at 55C for 1hr.
- Prepare Ampligase mix - 1uL AmpLigase + 10uL Buffer + 89uL H2O
- Aspirate PBS in rolony sample and wash with PBS once
- Add AmpLigase mix to sample dish, and incubate in the oven at 45C for 4hr.
- Run 2nd RCA from Padlock probes
- Pre-anneal RCA primer (2uL of 100uM in 98uL 2x SSC) 60°C for 15min
- Add RCA master mix with aa-dUTP, run RCA for 20 hr.
- Fix 2nd RCA with BS(PEG)9, and deactivate BS(PEG)9 with Tris pH8.0 treatment
- Image ACTB on 2nd rolonies and Cy5 channel (1st rolonies)
- Decoding probe mixture: 10uL dcProbe0-Cy3 (10uM)+ 1uL Cy5-adapter for 1st rolony (100uM) + 89uL 2x SSC
- Pre heat probe mixture at 60C for 5min
- Add probe mixture to rolony sample and cool down at RT for 10min
- Wash with PBS twice and add 2mL PBS, and imaging
- Image RAB7A on 2nd rolonies and Cy5 channel (1st rolonies)
- Strip probes by adding 80% Formamide in 2x SSC (pre-heat at 60C for 5min, and add and incubate at RT for 10min, and wash with PBS)
- Decoding probe mixture: 10uL dcProbe1-Cy3 (10uM)+ 1uL Cy5-adapter for 1st rolony (100uM) + 89uL 2x SSC
- Pre heat probe mixture at 60C for 5min
- Add probe mixture to rolony sample and cool down at RT for 10min
- Wash with PBS twice and add 2mL PBS, and imaging
- 2nd Rolony generation at 09/10~09/11, imaging at 09/11
Result
- 1st Padlock probes for ACTB were not seen well, too sparse and too few
- 2nd Padlock probes for RAB7A were many, more than ACTB.
- Currently we don't know why there are not many signal on 2nd rolonies, becuase of...
- Ampligase reaction were not good? or low efficiency? becuase of temperature in oven? incubation time?
- Not enough padlock probes? or poor hybrizing efficiency?
- need to figure out
- We need to check all of 2nd rolonies, so we are going to use FITC-labeled probes which is the sequence for the region of 2nd RCA probes (488nm dye labeled CTTCAGCTTCCCGATATC)