Hosuk:LabNotes/2013-9-12: Difference between revisions
Jump to navigation
Jump to search
>Hosuki78 No edit summary |
>Hosuki78 |
||
Line 147: | Line 147: | ||
*Overlapped RAB7A : 791 | *Overlapped RAB7A : 791 | ||
** 791/29641 = 2.67% | ** 791/29641 = 2.67% | ||
*[[Media:RAB7A_Overlapped_1stRolony_2013-09-12.tif|Raw]] | **[[Media:RAB7A_Overlapped_1stRolony_2013-09-12.tif|Raw]] | ||
[[File:RAB7A_Overlapped_1stRolony_2013-09-12.png|600px]] |
Latest revision as of 21:18, 25 October 2013
Gene decoding with Barcoded Padlock probes[edit]
Experimental plan[edit]
- Hybridizing padlock probes on 1st rolonies, and
- Generate 2nd rolonies over 1st rolonies, and
- Observe each different fluorescent signal from 2nd rolonies
Procedure[edit]
- Prepare two barcoded padlock probes - ACTB, RAB7A
Padlock probe for ACTB[edit]
- ppACTB : /5Phos/CTGTGCTCGCGGGGCG CTTCAGCTTCCCGATATC CGACGG ACGTATCGGTAGTCGCAACGCA GGCAAAGGCGAGGCT --> 77bp
- two arms : CTGTGCTCGCGGGGCG, GGCAAAGGCGAGGCT
- site for decoding probes (dcProbe0-Cy3) : ACGTATCGGTAGTCGCAACGCA --> 22bp
- site for 2nd RCA probes : CTTCAGCTTCCCGATATC --> 18bp
Padlock probe for RAB7A[edit]
- ppRAB7A : /5Phos/GAAGCGAGAAGGTCCAAGTTCTG CTTCAGCTTCCCGATATC CGACGG GTCTTGCGTGCGATACGGAGTA GAGGAGACTAAACGGAGGACA --> 90bp
- two arms : GAAGCGAGAAGGTCCAAGTTCTG, GAGGAGACTAAACGGAGGACA
- site for decoding probes (dcProbe1-Cy3) : GTCTTGCGTGCGATACGGAGTA --> 22bp
- site for 2nd RCA probes : CTTCAGCTTCCCGATATC --> 18bp
2nd RCA probe[edit]
- FISSEQ_ppRCA : GATATCGGGAAGCTGA*A*G --> 18bp
Overall Process[edit]
- Prepare each probes – the concentration of each probes are resuspended to 200uM for each ACTB, RAB7A and 2nd RCA primer.
- Hybridize Padlock probe – mixture: 1uL ACTB + 1uL RAB7A + 98uL 2x SSC
- Add mix, and incubate dish in the oven at 55C for 1hr.
- Prepare Ampligase mix - 1uL AmpLigase + 10uL Buffer + 89uL H2O
- Aspirate PBS in rolony sample and wash with PBS once
- Add AmpLigase mix to sample dish, and incubate in the oven at 45C for 4hr.
- Run 2nd RCA from Padlock probes
- Pre-anneal RCA primer (2uL of 100uM in 98uL 2x SSC) 60°C for 15min
- Add RCA master mix with aa-dUTP, run RCA for 20 hr.
- Fix 2nd RCA with BS(PEG)9, and deactivate BS(PEG)9 with Tris pH8.0 treatment
- Image ACTB on 2nd rolonies and Cy5 channel (1st rolonies)
- Decoding probe mixture: 10uL dcProbe0-Cy3 (10uM)+ 1uL Cy5-adapter for 1st rolony (100uM) + 89uL 2x SSC
- Pre heat probe mixture at 60C for 5min
- Add probe mixture to rolony sample and cool down at RT for 10min
- Wash with PBS twice and add 2mL PBS, and imaging
- Image RAB7A on 2nd rolonies and Cy5 channel (1st rolonies)
- Strip probes by adding 80% Formamide in 2x SSC (pre-heat at 60C for 5min, and add and incubate at RT for 10min, and wash with PBS)
- Decoding probe mixture: 10uL dcProbe1-Cy3 (10uM)+ 1uL Cy5-adapter for 1st rolony (100uM) + 89uL 2x SSC
- Pre heat probe mixture at 60C for 5min
- Add probe mixture to rolony sample and cool down at RT for 10min
- Wash with PBS twice and add 2mL PBS, and imaging
- 2nd Rolony generation at 09/10~09/11, imaging at 09/11
Result for 1st try[edit]
result[edit]
- 1st Padlock probes for ACTB were not seen well, too sparse and too few
- 2nd Padlock probes for RAB7A were many, more than ACTB.
- Currently we don't know why there are not many signal on 2nd rolonies, becuase of...
- Ampligase reaction were not good? or low efficiency? becuase of temperature in oven? incubation time?
- Not enough padlock probes? or poor hybrizing efficiency?
- need to figure out
- We need to check all of 2nd rolonies, so we are going to use FITC-labeled probes which is the sequence for the region of 2nd RCA probes (488nm dye labeled CTTCAGCTTCCCGATATC)
- We didn't do quantitative analysis yet, and will image this sample (RAB7A) with Confocal.
Number of Rolonies[edit]
- Use Matlab code (D:\My Documents\..\04. Matlab\Rolony_Counting_3.m)
- Use epi FL ficture (2013-09-11)
- ACTB : 1st Rolony --> 3931, 2nd(ACTB) --> 67
- ACTB/1st = 1.70%
- RAB7A : 1st Rolony --> 4085, 2nd(RAB7A) --> 204
- RAB7A/1st = 4.99%
Figures - epi FL[edit]
- Rolony sample made at 2013-06-23, 3uL phi29, 20x obj
ACTB on 2nd rolonies[edit]
1st Rolonies, Cy5 (Raw) | ACTB on 2nd Rolonies, Cy3 (Raw) | Mergerd | |||
File:S062319 1stRolony-Cy5 GeneACTB-Cy3 P02 Fig01 FLCy5 red.jpg | File:S062319 1stRolony-Cy5 GeneACTB-Cy3 P02 Fig02 FLCy3 cyan.jpg | File:Composite ACTB P02.jpg |
RAB7A on 2nd rolonies[edit]
1st Rolonies, Cy5 (Raw) | RAB7A on 2nd Rolonies, Cy3 (Raw) | Mergerd | |||
File:S062319 1stRolony-Cy5 GeneRAB7A-Cy3 P02 Fig02 FLCy5 EM20 red.jpg | File:S062319 1stRolony-Cy5 GeneRAB7A-Cy3 P02 Fig01 FLCy3 EM40 cyan.jpg | File:Composite RAB7A P02.jpg |
Figures - Confocal[edit]
- Image RAB7A sample only
- 20x obj, oil
- Red : Cy5 (1st Rolony)
- Green : Cy3 (2nd, RAB7A)
- 2048 x 2048 resolution, FOV : 580um x 580um with zoom 1x
- Z stack(10um), and maximum projection
location 1, Zoom = 1x (Raw, Cropped) | location 2, Zoom = 2x (Raw) | ||
File:Confocal RAB7A Red-1stRolony Green-2ndRolony pos01 zoom1x 2.png | File:Confocal RAB7A Red-1stRolony Green-2ndRolony pos02 zoom4x.png |
Counting RAB7A (added at 2013-10-25)[edit]
- Rolony_Counting_10.m
- 1st Rolony : 29641
- 2nd Rolony (RAB7A) : 2811
- Overlapped RAB7A : 791
- 791/29641 = 2.67%
- Raw