Hosuk:LabNotes/2013-12-30: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Hosuki78
(Created page with "*LabNote ===RT primer annealing specific position in mRNA=== ====Primer Design==== *Target gene : RAB7A *RAB7A mRNA target sequence: CAGAACTTGGACCTTCTCGCT...")
 
>Hosuki78
No edit summary
 
(4 intermediate revisions by the same user not shown)
Line 22: Line 22:


====Rolony Fab.====
====Rolony Fab.====
*Use 96 well plate
*Use 96 well plate (12/28~12/30)
**Control : Random Hexamer
**Control : Random Hexamer
[[File:PGP1F_96well_RTpositionTest_Cells_2.png|1200px]]
[[File:PGP1F_96well_RTpositionTest_Cells_2.png|450px]]
 
 
 
====Result====
*Rolonies from 1000b primer were too many, they are much more than control (random hexamer).
*There is a trend, 220b and 300b primer sample don't have many rolonies which are almost similar number that we've seen so far with RAB7A detection.
*However 500b sample showed more rolonies, and 1000b sample has too many and too much strong signal.
*I'm not sure the signal from 1000b sample is real signal or something other things...because it's too much.
*But since I've made 4 wells per each sample, and all 4 wells have the sample result per each primer, so I think these images shows some meaningful results.
 
*Raw images : [[Media:MIP_RTPrimer_RAB7A_C3_Hexamer-1_Step1_Pos1.tif|Control]], [[Media:MIP_RTPrimer_RAB7A_D3_D220-1_Step1_Pos1.tif|D220]], [[Media:MIP_RTPrimer_RAB7A_D7_D300-1_Step1_Pos1.tif|D300]], [[Media:MIP_RTPrimer_RAB7A_E3_D510-1_Step1_Pos1.tif|D510]], [[Media:MIP_RTPrimer_RAB7A_E7_D1000-1_Step1_Pos1.tif|D1000]]
*[[File:MIP_RTPrimer_1stRolony_Compare.png|800px]]
 
 
*1st Rolony Counts
[[File:PGP1F_96well_RTpositionTest_1stRolonyCount.png|800px]]
 
 
*PISA parameters
**Gaussian Std : 3
**Gaussian Upper : -2e-4
**area upper: 50
**area lower: 4
**axratio lower: 0.6
**circ upper: 1.6
**circ lower: 0.8
**perim conn: 8
**bkgmult lower: 4
 
 
====Result : RAB7A Target on 1st Rolony====
*ATTO550-RAB7A on 1st Rolony probes : '''NO signal at all! WHY?'''
**I annealed Cy3 1st Rolony probes : showed the same signals to the previous Cy5 1st Rolony probes… so there are still 1st Rolonies…BUT then why there are no 1st  Rolonies with RAB7A targets?

Latest revision as of 18:31, 10 January 2014

RT primer annealing specific position in mRNA[edit]

Primer Design[edit]

  • Target gene : RAB7A
  • RAB7A mRNA target sequence: CAGAACTTGGACCTTCTCGCTTCTGTCCTCCGTTTAGTCTCCTC
    • This is base 125-177
  • Choose primers that are 10bp long while minimizing GC content and ~200bp, ~300bp, ~500bp, and ~1000bp from TSS


  • mRNA target of RAB7A 220b distance from TSS : CGCGTTTGAA
  • mRNA target of RAB7A 300b distance from TSS : ACTCATGAAC
  • mRNA target of RAB7A 510b distance from TSS : CAACACATTC
  • mRNA target of RAB7A 1000b distance from TSS: TTACACCCCA


  • RT_RAB7A_220b: [/5Phos/TCTCGGGAACGCTGAAGA] + TTCAAACGCG (--> D220)
  • RT_RAB7A_300b: [/5Phos/TCTCGGGAACGCTGAAGA] + GTTCATGAGT (--> D300)
  • RT_RAB7A_510b: [/5Phos/TCTCGGGAACGCTGAAGA] + GAATGTGTTG (--> D510)
  • RT_RAB7A_1000b: [/5Phos/TCTCGGGAACGCTGAAGA] + TGGGGTGTAA(--> D1000)


Rolony Fab.[edit]

  • Use 96 well plate (12/28~12/30)
    • Control : Random Hexamer

File:PGP1F 96well RTpositionTest Cells 2.png


Result[edit]

  • Rolonies from 1000b primer were too many, they are much more than control (random hexamer).
  • There is a trend, 220b and 300b primer sample don't have many rolonies which are almost similar number that we've seen so far with RAB7A detection.
  • However 500b sample showed more rolonies, and 1000b sample has too many and too much strong signal.
  • I'm not sure the signal from 1000b sample is real signal or something other things...because it's too much.
  • But since I've made 4 wells per each sample, and all 4 wells have the sample result per each primer, so I think these images shows some meaningful results.


  • 1st Rolony Counts

File:PGP1F 96well RTpositionTest 1stRolonyCount.png


  • PISA parameters
    • Gaussian Std : 3
    • Gaussian Upper : -2e-4
    • area upper: 50
    • area lower: 4
    • axratio lower: 0.6
    • circ upper: 1.6
    • circ lower: 0.8
    • perim conn: 8
    • bkgmult lower: 4


Result : RAB7A Target on 1st Rolony[edit]

  • ATTO550-RAB7A on 1st Rolony probes : NO signal at all! WHY?
    • I annealed Cy3 1st Rolony probes : showed the same signals to the previous Cy5 1st Rolony probes… so there are still 1st Rolonies…BUT then why there are no 1st Rolonies with RAB7A targets?