Noi/NOTES/2014-10-15: Difference between revisions
Jump to navigation
Jump to search
>Noi (Created page with "* '''Link to calendar''' * 2014-10-15: Received :90k_oligos_30Sept2014 from CustomArray === Oligo info. === * Name: 90k_oligos_30Sept2014 * Conc. 69....") |
>Noi mNo edit summary |
||
Line 17: | Line 17: | ||
== Expansion PCR (Quick test, round1) == | == Expansion PCR (Quick test, round1) == | ||
* I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set) | * I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set) | ||
* I will include the two positive control for the two primer set to confirm that the amplification works fine. | * I will include the two positive control for the two primer set to confirm that the amplification works fine. Note that I combine F & R primer in final conc. 10uM in the same tube. | ||
Components Volume (ul) Final conc. | |||
Seed oligo (1694.3nM) 0.59 100nM | |||
F/R primer mix (10uM) 0.40 400nM | |||
2x KAPA SYBG fast MM 5.00 1x | |||
H2O 4.01 | |||
Total 10.00 | |||
* 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 18-> 72C 3min -> 15C hold | |||
* The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification |
Revision as of 17:08, 17 October 2014
- Link to calendar
- 2014-10-15: Received :90k_oligos_30Sept2014 from CustomArray
Oligo info.
- Name: 90k_oligos_30Sept2014
- Conc. 69.89ng/ul,
- Volume 80ul in TE buffer. Total amount XXug
- Info from Dr. Zhang's note
*Sept14 probe set: Media:90k_oligos_30Sept2014.txt.gz probe set # probes Length Amp primers Chris gDNA_MS_v2 8,045 127bp V6(G*T*CATATCGGTCACTGTU//5Phos/GGGTAGTGTGTATCCTG) Kun cancer_hyb_sept14 51,639 110-130bp V8(T*C*TAATCTAGCGCGACGTCU//5Phos/CCACAAGAGGCGCTATG) Kun LMS_selector 17,342 124-130bp NE(TGCCTAGGACCGGATCAACT/GCTTCGGTTCACGCAATG) Kun padlock_SNPs 12,974 125bp V4(G*A*CTGGAAGAGCACTGTU//5Phos/AGCCTCATGCGTATCCG) Total 90,000
- Length: I would use the average size of the oligo pool to calculate concentration ~125nt = MW=41250g/mole
- Conc. : 69.89 ng/ul = 1694.30 (69.89ng/ul/ 41250g/mole)
Expansion PCR (Quick test, round1)
- I initially work on the two subsets, including LMS_selector (NE or eMIP_CA1 primer set) and padlock_SNP (V4 primer set)
- I will include the two positive control for the two primer set to confirm that the amplification works fine. Note that I combine F & R primer in final conc. 10uM in the same tube.
Components Volume (ul) Final conc. Seed oligo (1694.3nM) 0.59 100nM F/R primer mix (10uM) 0.40 400nM 2x KAPA SYBG fast MM 5.00 1x H2O 4.01 Total 10.00
- 95C 30sec -> (95C 30sec -> 54C 45sec-> 72C 45sec) X 18-> 72C 3min -> 15C hold
- The qPCR curves of all reactions showed amplification very well ~16 cycles for the new probe set. I then continued to do expansion PCR in larger volume (150ul, 100uM of the template for each subset) without gel verification