Matt:LabNotes/2015-5-18: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Mzcai
>Mzcai
Line 91: Line 91:
| Total||||||||||20.00
| Total||||||||||20.00
|}
|}
<!--
===Add Sequence Adapters PCR===
====Primers====
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Primer'''
| align="center" style="background:#f0f0f0;"|'''Sequence'''
| align="center" style="background:#f0f0f0;"|'''Index #'''
|-
| ISB_CA_AF||AATGATACGGCGACCACCGAGATCTACACGCCTGCATATCGGGAAGCTGAAG||
|-
| ISB_CA_AR.T1||CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTGCCTTCCCGATATCCGACGG||Indx1
|-
| ISB_CA_AR.T2||CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTGCCTTCCCGATATCCGACGG||Indx2
|-
| ISB_CA_AR.T3||CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTGCCTTCCCGATATCCGACGG||Indx3
|}
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Sample'''
| align="center" style="background:#f0f0f0;"|'''Index'''
| align="center" style="background:#f0f0f0;"|'''Forward Primer'''
| align="center" style="background:#f0f0f0;"|'''Reverse Primer'''
|-
| 1||1||ISB_CA_AF||ISB_CA_AR.T1
|-
| 2||2||ISB_CA_AF||ISB_CA_AR.T2
|-
| 3||3||ISB_CA_AF||ISB_CA_AR.T3
|-
| 4||1||ISB_CA_AF||ISB_CA_AR.T1
|-
| 5||2||ISB_CA_AF||ISB_CA_AR.T2
|-
| 6||3||ISB_CA_AF||ISB_CA_AR.T3
|}
====PCR Test====
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Components'''
| align="center" style="background:#f0f0f0;"|'''1X Volume'''
| align="center" style="background:#f0f0f0;"|'''6.5X Volume'''
|-
| Captured template||1||0
|-
| 10uM Forward Primer||0.4||2.6
|-
| 10uM Reverse Primer||0.4||0
|-
| 2X KAPA SYBG MM||12.5||81.25
|-
| H2O||10.7||69.55
|-
| Total||25||153.4
|}
*Aliquot 23.6ul from 6.5X master mix and add 1ul captured template and 0.4ul corresponding reverse primer
  Program
  98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x15 -> 72C 3min
[[File:20150501_CA12kNov2014_invitroPCRtest.JPG | 650px]]
*Looks good; NTC are both negative so I won't amplify on next PCR
====PCR====
{| {{table}}
| align="center" style="background:#f0f0f0;"|'''Components'''
| align="center" style="background:#f0f0f0;"|'''1X Volume'''
| align="center" style="background:#f0f0f0;"|'''4.5X Volume'''
|-
| Captured template||12||0
|-
| 10uM Forward Primer||2||9
|-
| 10uM Reverse Primer||2||0
|-
| 2X KAPA SYBG MM||50||225
|-
| H2O||34||153
|-
| Total||100||387
|}
*Aliquot 86ul from 4.5X master mix and add 12ul captured template and 2ul corresponding reverse primer
  Program
  98C 30s -> (98C 10s -> 52C 20s -> 72C 20s)x8 -> (98C 10s -> 72C 20s)x13 -> 72C 3min
[[File:20150502_CA12kNov2014_invitroPCR.JPG|650px]]
*Bead purification with 1.5:1 Beads to amplicon volume ratio
**Eluted with 50ul total for each sample
===PAGE Check===
*Load 2ul of each sample + 2ul loading dye
[[File:2015-05-02_CA12kNov2014_invitro_gelcheck.jpg|450px]]
*Labeled tubes and put in "Non-quantified Sequencing Libraries"
**Sample1: MC20150502_CA12kNov14supp_V4gDNA-1
**Sample2: MC20150502_CA12kNov14supp_V4cDNA-2
**Sample3: MC20150502_CA12kNov14supp_V7gDNA-4
**Sample4: MC20150502_CA12kNov14supp_V7cDNA-5
-->

Revision as of 00:59, 20 May 2015

in vitro Capture with CA12k_Nov2014 + suppressor oligo v2 Probe Set

Sample Groups

  1. gDNA 12878 (80.3ng/ul)
    • Also a positive control and will be done using same volumes/amounts as all previous experiments
  2. cDNA dT BA8
    • ~1/10th of gDNA amount
    • cDNA N9 BA8
    • ~1/10th of gDNA amount
  3. Negative Control

gDNA

Probe:target 1000:1 '
Probe size 3514 probes
DNA templet 300 ng
gDNA MW 1.95x10^12 g/mol
gDNA (300ng) 1.5385x10^-19 mol
Probe (1000:1) 1.5385x10^-16 mol
Probe MW (3514, 150nt) 1.71585106x10^8 g/mol
Amount Probe req'd 26.4 ng
  • 461nM x (150nt*325Da/nt + 79Da) x 10^-6 L/ul = 22.5 ng/ul
    • Dilute to 16ul of 2.25ng/ul
    • 10X less probes in cDNA than gDNA
  • Make suppressor oligo pools with 5nM and 50nM of each supp oligos
    • 1000-fold more of each suppressor oligo: 1.5385x10^-16 mole * 1000 = 1.5385x10^-13 mole = 1.5385x10^-4 nmole = 50 nM * 3.1ul
    • 10X less probes in cDNA than gDNA
Sample # Sample Description Probes Target 1000X Supp Oligos 10X Ampligase Buffer H2O Total
1 gDNA 12 3.8 3.1 (50nM each) 3 8 30
2 cDNA dT 1.2 20 3.1 (5nM each) 3 2.7 30
3 cDNA N9 1.2 20 3.1 (5nM each) 3 2.7 30
4 NTC 1.2 20 3.1 (5nM each) 3 2.7 30
  • Add 40ul Mineral Oil on top

Program

  • 95C 30sec -> cool down to 55 C at 0.02C/sec -> 55 C 20h
    • In BioRad Thermalcycler program says: -0.2C per cycle every 30sec
  • -> add 3ul AmpLigase enzyme mix (0.5U/ul AmpLigase in 1X AmpLigase buffer)
  • -> 55 C 20h-> 94C 2min -> add 2ul Exo I/III mix-> 37C 2h -> 94C 2min -> 4C hold.

AmpLigase enzyme mix

Components Stock conc. Unit Final conc. Unit Prepare volume 30ul
AmpLigase 5 U/ul 0.5 U/ul 2.00
10x AmpLigase Buffer 10 x 1 x 2.00
H2O 16.00
Total 20.00