AlanFung:LabNotes/EZ/2009-3-22: Difference between revisions
>Alan6017518 |
>Alan6017518 No edit summary |
||
Line 1: | Line 1: | ||
='''EZ DNA Methylation Direct-GM20431 1000 & 100 cells | ='''EZ DNA Methylation Direct-GM20431 1000 & 100 cells= | ||
Line 74: | Line 74: | ||
*111.11 cells/uL | *111.11 cells/uL | ||
Dilute 10uL (1000cells/uL)cell suspension with 80uL UV treated PBS | Dilute 10uL (1000cells/uL)cell suspension with 80uL UV treated PBS IN PCR TUBE A | ||
*11.11 cells/uL | *11.11 cells/uL | ||
Dilute 10uL (111.11 cells/uL) cell suspension with 90 uL UV treated PBS | Dilute 10uL (111.11 cells/uL) cell suspension with 90 uL UV treated PBS IN PCR TUBE B | ||
*Sample Digestion with Proteinase K | *Sample Digestion with Proteinase K IN PCR TUBE A & B | ||
1rxn x 2 | |||
-------------------------------------------- | ----------------------------------------------- | ||
RNAse-free H2O 0.0 0.0 | RNAse-free H2O 0.0 0.0 | ||
Protinase K 1.0 1.0 | Protinase K 1.0 1.0 | ||
M-Digestion Buffer (2X) 10.0 10.0 | M-Digestion Buffer (2X) 10.0 10.0 | ||
-------------------------------------------- | ----------------------------------------------- | ||
Mix by repeat pipetting | Mix by repeat pipetting | ||
111.11 cells/uL 9.0 | 111.11 cells/uL 9.0 | ||
11.11 cells/uL 9.0 | 11.11 cells/uL 9.0 | ||
--------------------------------------------- | ----------------------------------------------- | ||
20uL 20uL | 20uL 20uL | ||
Latest revision as of 23:46, 23 March 2009
EZ DNA Methylation Direct-GM20431 1000 & 100 cells[edit]
Objective[edit]
- Confirmation of the bisulfite conversion of GM20431 for 100 cells with 1000 cells as positive control.
Samples & Materials[edit]
- GM20431 cells
- EZ DNA Methylation Direct Kit 03/11/09
- Primers - From IDT
-------------------------------------------------- 0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG 0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA 0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT 0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA 0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT 0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA --------------------------------------------------
- Creating 100uM primer
0.1_F_chr22 27.9nmol RNAse free H2O 279uL
0.1_R_chr22 31.8nmol RNAse free H2O 318uL
0.8_F_chr21 31.30nmol RNAse free H2O 313uL
0.8_R_chr21 31.70nmol RNAse free H2O 317uL
0.9_F_chr8 30.10nmol RNAse free H2O 301uL
0.9_R_chr8 29.30nmol RNAse free H2O 293uL
- Making 3.3uM primer working solution
Dilute 33uL 100uM primer with 967uL RNAse free H2O
- Jurkat gDNA (100ug/mL)
- Dilute 1uL stock gDNA with 99uL RNAse-free H20
- Agarose Gel
Overview[edit]
- Cell Preparation
- Bisulfite Conversion
- PCR amplification
- Agarose Gel Electrophoresis
Procedures[edit]
- Turn on the incubator heat it up to 50C
- Cell Preparation
Resuspended cells in T25 flask by repeat pipetting
Perform cell counting
- Cell Countof GM20431 P20: 555,000 cells/mL
To get 1,000,000 cells: 1,000,000/(555,000cells/mL)=1.80mL
aspirate 1mL + 800uL cell suspension and transfer to a 50mL centrifuge tube
Spin down at 10,000 rpm for 3 mins
Aspirate supernatant completely
Resuspended cells with 1000uL UV treated PBS (1000cells/uL)
- Cell Dilution
Performed cell dilution to reach concentration of 111.11 cells/uL and 11.11 cells/uL
- 111.11 cells/uL
Dilute 10uL (1000cells/uL)cell suspension with 80uL UV treated PBS IN PCR TUBE A
- 11.11 cells/uL
Dilute 10uL (111.11 cells/uL) cell suspension with 90 uL UV treated PBS IN PCR TUBE B
- Sample Digestion with Proteinase K IN PCR TUBE A & B
1rxn x 2 ----------------------------------------------- RNAse-free H2O 0.0 0.0 Protinase K 1.0 1.0 M-Digestion Buffer (2X) 10.0 10.0 ----------------------------------------------- Mix by repeat pipetting 111.11 cells/uL 9.0 11.11 cells/uL 9.0 ----------------------------------------------- 20uL 20uL
Incubate the samples at 50C for 20 mins
- Bisulfite Conversion of DNA
Add in 130uL of CT conversion Reagent Solution into a labeled PCR tube
Extract 20uL of sample supernatant
Mix by repeat pipetting
Centrifuge briefly to ensure no droplets are in the cap or side of the tube
Perform reaction in thermocycler
Step1 98C, 8m Step2 64C, 3.5hr Step4 4C, storage for up to 20 hr
Add 600uL of M-Bindin Buffer into a IC Column and place column into a collection tube Load samples into IC column
CLOSE CAP AND MIX BY INVERTING THE COLUMN SEVERAL TIMES
Centrifuge at (max speed) 20,000g for 30s Discard flow through
Add 100uL M-Wash Buffer to column Repeat Centrifuge
Add 200uL of M-Desulphonation Buffer to column let stand at RT for 20m Repeat centrifuge step
Add 200uL of M-Wash Buffer to the column Repeat Centrifuge Repeat washing step
Place column in a 1.5mL tube Add in 10uL of M-Elution Buffer directly to the column matix Repeat Centrifuge
- PCR
Sample A 100 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 0.5 0.5 0.5 RNAse free H20 7.5 7.5 7.5 ------------------------------------------------- Total 40uL
Sample B 10 cell GM20431 A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 0.5 0.5 0.5 RNAse free H20 7.5 7.5 7.5 ------------------------------------------------- Total 40uL
Sample C 0.6ng Jurkat gDNA A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 0.5 0.5 0.5 RNAse free H20 7.5 7.5 7.5 ------------------------------------------------- Total 40uL
Sample D 0.06ng Jurkat gDNA A B C ------------------------------------------------- CHR22 CHR21 CHR8 2X iQ Super Mix 20 20 20 Primer F (3.3uM) 6 6 6 Primer R (3.3uM) 6 6 6 gDNA 0.5 0.5 0.5 RNAse free H20 7.5 7.5 7.5 ------------------------------------------------- Total 40uL
A-CHR22 F/R
B-CHR21 F/R
C-CHR8 F/R
Perform PCR reaction in thermocycler
Step1 96C, 3m Step2 95C, 30s Step3 62C, 1m Step4 72C, 1m Step5 Go to step2 repeat 39 times Step6 72C, 5m Step7 4C, Forever
- Gel Electrophoresis
Gel 1 Well 1 2 3 4 5 6 7 8 ----------------------------------------------------------------- Content Blank AA AB AC CA CB CC Ladder Sample 0 6 6 6 6 6 6 3 0.5X TBE Buffer 0 4 4 4 4 4 4 3 6X Loading Dye 0 4 4 4 4 4 4 3 ----------------------------------------------------------------- Total 14uL 9uL
- Run gel at 135 V for 20 min.
Results[edit]
File:ZhangLab 2 2009-03-23 12hr 00min crop.jpg
Suggestion[edit]
- Repeat experiment with 100 cells