AlanFung:LabNotes/EZ/2009-3-23: Difference between revisions

From ZhangLabWiki
Jump to navigation Jump to search
>Alan6017518
 
(3 intermediate revisions by the same user not shown)
Line 202: Line 202:


==Results==
==Results==
[[Image:ZhangLab_2 2009-03-24 11hr 46min_crop.jpg]]
*No bands showed up for the 10 cells methylation at all
*Only CHR22 and CHR21 primers showed up for 100 cells methylation, result is the same as previous experiment


==Suggestion==
==Suggestion==
Increase 0.5uL gDNA template to 10uL

Latest revision as of 00:46, 25 March 2009

EZ DNA Methylation Direct-GM20431 100 & 10 cells[edit]

Objective[edit]

  • Confirmation of the bisulfite conversion of GM20431 for 100 and 10 cells.
  • Repeat with same conditon asprevious 100 cells DNA Methylation to try to get the CHR8 primer to work.


Samples & Materials[edit]

  • GM20431 cells
  • EZ DNA Methylation Direct Kit 03/11/09
  • Primers - From IDT
  --------------------------------------------------
  0.1_F_chr22_31384238GTGAATAGGTTAAGTGAGGTAGAAG
  0.1_R_chr22_31384238AAAAAAATCAAACACCAACTATAAA
  0.8_F_chr21_39672131AAAATATTGGGATTATAGGTATGAGT
  0.8_R_chr21_39672131AACTTCTAAACTAACCAAAACAAAA
  0.9_F_chr8_119031762TTATAGTTTGGGTGATAGAGTAAGATT
  0.9_R_chr8_119031762AAACCCTAAACAAAATACTCAATATAA
  --------------------------------------------------
  • Creating 100uM primer
0.1_F_chr22         27.9nmol 
RNAse free H2O      279uL
0.1_R_chr22         31.8nmol
RNAse free H2O      318uL
0.8_F_chr21         31.30nmol
RNAse free H2O      313uL
0.8_R_chr21         31.70nmol
RNAse free H2O      317uL
0.9_F_chr8          30.10nmol
RNAse free H2O      301uL
0.9_R_chr8          29.30nmol
RNAse free H2O      293uL

  • Making 3.3uM primer working solution

Dilute 33uL 100uM primer with 967uL RNAse free H2O

  • Jurkat gDNA (100ug/mL)
  • Dilute 1uL stock gDNA with 99uL RNAse-free H20
  • Agarose Gel

Overview[edit]

  • Cell Preparation
  • Bisulfite Conversion
  • PCR amplification
  • Agarose Gel Electrophoresis

Procedures[edit]

  • Turn on the incubator heat it up to 50C
  • Cell Preparation


Resuspended cells in T25 flask by repeat pipetting Perform cell counting

  • Cell Count of GM20431 P20: 144,969 cells/mL


To get 1,000,000 cells: 1,000,000/(144,969cells/mL)=6.898mL aspirate 6mL + 898uL cell suspension and transfer to a 50mL centrifuge tube Spin down at 10,000 rpm for 5 mins Aspirate supernatant completely Resuspended cells with 1000uL UV treated PBS (1000cells/uL)

  • Cell Dilution

Performed cell dilution to reach concentration of 11.11 cells/uL and 1.11 cells/uL

  • 111.11 cells/uL

Dilute 10uL (1000cells/uL)cell suspension with 80uL UV treated PBS

  • 11.11 cells/uL

Dilute 10uL (111.11 cells/uL) cell suspension with 90 uL UV treated PBS

  • 1.11 cells/uL

Dilute 10uL (11.11 cells/uL) cell suspension with 90 uL UV treated PBS


  • Sample Digestion with Proteinase K
                              1rxn x 2
     --------------------------------------------
     RNAse-free H2O              0.0        0.0
     Protinase K                 1.0        1.0
     M-Digestion Buffer (2X)     10.0       10.0
     --------------------------------------------
     Mix by repeat pipetting
     111.11 cells/uL             9.0        
     11.11 cells/uL                         9.0
     ---------------------------------------------
                                 20uL       20uL

Incubate the samples at 50C for 20 mins

  • Bisulfite Conversion of DNA

Add in 130uL of CT conversion Reagent Solution into a labeled PCR tube

Extract 20uL of sample supernatant

Mix by repeat pipetting

Centrifuge briefly to ensure no droplets are in the cap or side of the tube

Perform reaction in thermocycler

      Step1   98C, 8m
      Step2   64C, 3.5hr
      Step4   4C,  storage for up to 20 hr

Add 600uL of M-Bindin Buffer into a IC Column and place column into a collection tube Load samples into IC column

CLOSE CAP AND MIX BY INVERTING THE COLUMN SEVERAL TIMES

Centrifuge at (max speed) 20,000g for 30s Discard flow through

Add 100uL M-Wash Buffer to column Repeat Centrifuge

Add 200uL of M-Desulphonation Buffer to column let stand at RT for 20m Repeat centrifuge step

Add 200uL of M-Wash Buffer to the column Repeat Centrifuge Repeat washing step

Place column in a 1.5mL tube Add in 10uL of M-Elution Buffer directly to the column matix Repeat Centrifuge


  • PCR


 Sample A 100 cell GM20431
                     A         B         C
 -------------------------------------------------
                     CHR22     CHR21     CHR8
 2X iQ Super Mix     20        20        20
 Primer F (3.3uM)    6         6         6  
 Primer R (3.3uM)    6         6         6     
 gDNA                0.5       0.5       0.5   
 RNAse free H20      7.5       7.5       7.5  
 -------------------------------------------------
 Total                                   40uL


 Sample B 10 cell GM20431
                     A         B         C
 -------------------------------------------------
                     CHR22     CHR21     CHR8
 2X iQ Super Mix     20        20        20
 Primer F (3.3uM)    6         6         6  
 Primer R (3.3uM)    6         6         6     
 gDNA                0.5       0.5       0.5   
 RNAse free H20      7.5       7.5       7.5  
 -------------------------------------------------
 Total                                   40uL


A-CHR22 F/R
B-CHR21 F/R
C-CHR8  F/R


Perform PCR reaction in thermocycler

      Step1   96C, 3m
      Step2   95C, 30s
      Step3   62C, 1m
      Step4   72C, 1m
      Step5   Go to step2 repeat 39 times
      Step6   72C, 5m
      Step7   4C,  Forever
  • Gel Electrophoresis
                                 Gel 1
Well             1     2     3     4     5    6     7      8
-----------------------------------------------------------------
Content          Blank AA    AB    AC    BA   BB    BC     Ladder
Sample           0     10    10    10    10   10    10     3
6X Loading Dye   0     2     2     2     2    2     2      3
-----------------------------------------------------------------
Total                                               14uL   9uL



  • Run gel at 135 V for 20 min.

Results[edit]

File:ZhangLab 2 2009-03-24 11hr 46min crop.jpg

  • No bands showed up for the 10 cells methylation at all
  • Only CHR22 and CHR21 primers showed up for 100 cells methylation, result is the same as previous experiment

Suggestion[edit]

Increase 0.5uL gDNA template to 10uL